1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KiRa [710]
3 years ago
10

Please i need help !!!☹️

Biology
1 answer:
Pavlova-9 [17]3 years ago
6 0

Answer: C. 9

Explanation:

Gestation refers to the time between when a baby is conceived till the baby is delivered. This is why the period of pregnancy is known as the <em>Gestation Period. </em>

During that time and after the fertilized egg implants itself in the uterus, the baby develops and grows until it is ready to be delivered.

The structure this occurs in is the uterus (womb) which is labelled 9 in the structure above.

You might be interested in
Why would scientists conduct investigations on a newly discovered alternative fuel?
klio [65]

Answer:

why would scientists conduct investigations on a newly discovered alternative fuel?

to confirm that the alternative fuel is cleaner than fuels currently used​

Explanation:

As an alternative fuel, it must be validated whether it is better than the one currently in use

7 0
3 years ago
Which feature is charatisic of estauries
dusya [7]

The estauries are characterized by mix of fresh water and salt water. That is option A

<h3>What is estauries?</h3>

Estauries is defined as the part of water where many rivers meet and sweep into the ocean.

The characteristics of estauries include the following;

  • The salty water mixed with freshwater resulting to brackish water formation.

  • The gradient of salinity in a semi-enclosed coastal system.

Learn more about brackish water here:

brainly.com/question/7385521

#SPJ1

Which feature is characteristics of estauries:

A mix of fresh water and salt water.

swap-like land.

region of land that drains into a body of water.

the gradient of salinity in a semi-enclosed coastal system.

4 0
2 years ago
Wha is 3 things countrys need to do to help global warming
Hoochie [10]

Answer:

The measures which is taken by country need to prevent global warming are given below.

1) The government of the country should planted more trees because plants are only organisms which reduces the concentration of harmful gases which causes global warming.

2) Reduce the use of fossil fuels such as petrol, coal and methane gas.

3) Use solar energy instead of fuel for the production of electricity and other industrial products.

4 0
3 years ago
What are the advantages of having a tall car/vehicle
HACTEHA [7]
This may sound terrible but less damage in a collision, and also view 
8 0
3 years ago
In Drosophila, vestigial (partially formed) wings (vg) are recessive to normal long wings (vg+) and the gene for this trait is a
Marina CMI [18]

Answer/ Explanation:

a. The genotype of a homozygous white eyed long winged female would be Vg+Vg+XrXr. We denote the white allele as recessive (r) because the XY male only has one copy and yet has red eyes, so the red eye trait (R) must be dominant. A homozygous red eyed vestigial winged male would have be VgVgXRY. The possible gametes for the female are Vg+Xr only. For the male, the possible gametes are VgXR or VgY

The attached punnett square shows the results of the cross. The females will all be Vg+VgXRXr. The males will all be Vg+VgXRY (must inherit Y from father). That means they will all  have normal length wings, the males will have white eyes and the females will have red eyes.

b. The F2 flies arise from intercrossing the F1, so the cross will be Vg+VgXRXr x Vg+VgXRY. The possible gametes for the mother are: Vg+XR, Vg+Xr, VgXR or VgXr. The possible gametes for the father are Vg+Xr

, Vg+Y

, VgXr

, VgY

. The attached punnet square shows this cross. The ratio of the phenotypes will be 6:6:2:2, or 3:3:1:1 (long-winged red eye: long-winged white eye: vestigial wing red eye: vestigial wing white eye), genotypes shown in the attachment.

c. F1 cross back to the mother would be Vg+VgXRY x Vg+Vg+XrXr. The genotypes are shown in the attached punnet square. The offspring will all be long-winged with white eyes. The F1 to the father would be Vg+VgXRXr x VgVgXRY. The ratio would be 3:3:1:1 long-winged red eye: long-winged white eye: vestigial wing red eye: vestigial wing white eye

Download docx
7 0
3 years ago
Other questions:
  • Distinguish between the bottom-up and top-down models of community organization.
    10·1 answer
  • Variety in species exists because of___.
    14·1 answer
  • Which of the following actions could prevent mass-movement disasters?
    11·1 answer
  • Please comment the answer, fast!!!!
    15·1 answer
  • (50 Points)
    14·1 answer
  • Materials that allow the charges of an electric current to move freely through them are called a. Insulators. B. Conductors. C.
    15·1 answer
  • 7. How is parasitism different from other types of symbiosis?
    8·1 answer
  • Write the complementary bases of the strand below according to the base pair rule. ATC CAG TAG GAC
    7·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • How do the roots and stem take part in the transport of water in a plant?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!