1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nadusha1986 [10]
3 years ago
14

One adaptation that is unique to marine mammals is they (2 points)

Biology
2 answers:
solniwko [45]3 years ago
7 0
They can slow their heartbeat down
N76 [4]3 years ago
5 0
<span>mammals</span> nurse their young hop it helps
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Describe the trophic structure of energy in an ecosystem
ale4655 [162]
As you go up in an ecosystem the bigger animals have less energy. While the organisms down at the bottom like plants that create their own energy have greater amounts. This is because energy is rated doing everyday things. As energy travels up the food pyramid, it looses more and more energy. This is knower as the 10% rule. In which every time you go up 10% of energy is lost.
5 0
3 years ago
What occurs after cytokinesis is completed at the end of meiosis I?
Ksenya-84 [330]

Answer:

c

Explanation:because i know

5 0
3 years ago
Read 2 more answers
Which level of organization is seen in both arachnoidiscus ehrenbergii and the stomach?
Nesterboy [21]
The answer is cell. In the cell level of organization arachnoidiscus enhrenbergii and the stomach can be seen.
7 0
3 years ago
Do you think it would be possible to construct a pyramid where the number of carnivores was more than the number of herbivores?
kondaur [170]

Answer:

Explanation:

Pyramid is the use of graph to represents the flow of energy in each trophic level. There are five trophic level and each has its own energy level pyramid help to show the energy at each level.

Each energy level must have at least One tenth of the energy level of the organisms before itself, this indicates that the energy in the lower tropic level is higher than the trophic level above.

Hence, carnivores cannot be more than herbivores in a biomass they need enough of herbivores to survive in the biomass as the energy level moves from the herbivores to the carnivores.

3 0
3 years ago
Other questions:
  • The finite resources of earth are often affected by increasing human consumption. These finite resources are what?
    12·1 answer
  • Which best describes what happens to a developing fetus during the third trimester?
    14·2 answers
  • If you wanted to observe a living organism-an amoeba, for example-which type of microscope would you use?
    7·1 answer
  • What other three things do Volvox also likely lack?
    7·1 answer
  • Some viruses have RNA in place of DNA? TRUE FALSE
    6·2 answers
  • genetic engineering is widely used in the field of agriculture and medicine. justify the impact of genetic engineering on humans
    15·1 answer
  • True/False- A magnet can be strong enough to erase computer evidence.
    9·1 answer
  • Adenine bonds with<br> Your answer
    11·1 answer
  • What does it mean to analyze data?
    9·2 answers
  • Which of the following is the model of DNA replication that best accounts for our current understanding of the genetic replicati
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!