Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
As you go up in an ecosystem the bigger animals have less energy. While the organisms down at the bottom like plants that create their own energy have greater amounts. This is because energy is rated doing everyday things. As energy travels up the food pyramid, it looses more and more energy. This is knower as the 10% rule. In which every time you go up 10% of energy is lost.
Answer:
c
Explanation:because i know
The answer is cell. In the cell level of organization arachnoidiscus enhrenbergii and the stomach can be seen.
Answer:
Explanation:
Pyramid is the use of graph to represents the flow of energy in each trophic level. There are five trophic level and each has its own energy level pyramid help to show the energy at each level.
Each energy level must have at least One tenth of the energy level of the organisms before itself, this indicates that the energy in the lower tropic level is higher than the trophic level above.
Hence, carnivores cannot be more than herbivores in a biomass they need enough of herbivores to survive in the biomass as the energy level moves from the herbivores to the carnivores.