1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
topjm [15]
2 years ago
11

Name 2 ways that the products of mitosis and meiosis are different in humans

Biology
1 answer:
OLEGan [10]2 years ago
8 0

Answer:

Mitosis involves the division of body cells, while meiosis involves the division of sex cells. The division of a cell occurs once in mitosis but twice in meiosis.

You might be interested in
Which statement describes functions of anti bodies
creativ13 [48]

Answer:

Explanation:

Antibodies have three main functions: 1) Antibodies are secreted into the blood and mucosa, where they bind to and inactivate foreign substances such as pathogens and toxins (neutralization). 2) Antibodies activate the complement system to destroy bacterial cells by lysis (punching holes in the cell wall).

6 0
3 years ago
What term is defined as the tendency of some members of a population to be better able to survive and reproduce and pass on thei
zaharov [31]
Adaptation is the tendency of some members of a population to be better able to survive and reproduce and pass on their characteristics.
5 0
4 years ago
What is 2 squared plus 18 times 13​
Brums [2.3K]
Square root of 29 or 5.38516
7 0
3 years ago
Read 2 more answers
Carrying capacity is _____________ and represented by letter ____ on the graph.
pshichka [43]
C is the right answer
7 0
3 years ago
Why is the ability of the cell membrane to be "picky" important?
Yuliya22 [10]

Answer:

Hi there!

Your answer is:

It is very important for the cell membrane to be <em>semi-permeable</em> because the ability to pick and choose what comes in and out of the cell keeps the cell safe! The membrane can choose to block out nasty germs and can also choose to get rid of internal waste.

An example of when this is important is in this scenario:

Let's say the cells are in a really salty solution. Naturally, salt will want to pull the water out of the cell. If the membrane <u>wasn't</u><u> </u> semi permeable, the water would listen to the salt and leave the cell. This would cause cell death. <u>BECAU</u><u>SE</u> the membrane is semi permeable, they can choose <em>not</em> to give the salt any water, keeping them alive

Hope this helps

5 0
3 years ago
Other questions:
  • Explain the four steps of the calvin cycle
    15·1 answer
  • What happens to an animal cell if too much water enters the cell via osmosis?
    7·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Using data, provide evidence that evolution is an ongoing process.
    11·1 answer
  • Matter can be divided into 2 categories: pure substances and mixtures.
    13·1 answer
  • What did the structure of DNA’s double helix suggest about DNA’s properties?
    13·1 answer
  • Which statement is true?
    6·2 answers
  • True or false? adding heat or taking it away can change matter from one state to another.
    5·2 answers
  • By locating active __________, geologists determine the likelihood of earthquakes in a region
    14·2 answers
  • The process that requires energy (atp) for digested nutrients to pass through the small intestinal wall into the villi is called
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!