1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lena [83]
3 years ago
6

Type your response in the box. The sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, wha

t should the nucleotides on the other strand be? Start with the top of the strand and work down
Biology
2 answers:
Marianna [84]3 years ago
5 0

Answer:

The correct answer is- TAAGCCGATAAATGCTAACGGTA.

Explanation:

DNA is a nucleic acid molecule made of two strands. Each strand is made up of nucleotide bonded via phosphodiester bonds. Each nucleotide is made up of- 5C deoxyribose sugar, a phosphate group and nitrogenous bases.  

DNA replication produces an exact copy of the DNA molecule through complementary base pairing. The complementary strand is formed by adding nucleotide through DNA polymerase which adds base pairs according to the Chargaff rule.  The Chargaff rule states that A will bind T via two hydrogen bonds and G will bind C via three hydrogen bonds.

Therefore, the complementary strand will be-TAAGCCGATAAATGCTAACGGTA

Sedaia [141]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Just had it on a quiz, got it right.

You might be interested in
What is attracted to the oxygen atom in a water molecule?
aivan3 [116]

Answer:

a.

Explanation:

The slight positive charges on the hydrogen atoms in a water molecule attract the slight negative charges on the oxygen atoms of other water molecules. This tiny force of attraction is called a hydrogen bond.

7 0
3 years ago
Read 2 more answers
Which molecule is secreted from the peritubular capillary network into the convoluted tubules?
kow [346]
The correct answer is  H+.
<span>Secretion from the peritubular capillary network into the convoluted tubules is a process called tubular secretion. This is an important process for both waste removal and acid-base balance. The secretion step is usually used to remove drugs, toxins, and poisons, or other molecules such as potassium (K+) and hydrogen (H+). The secreted molecules come from the peritubular capillaries and pass through the interstitial fluid before going through the wall of the tubule into the lumen of the tubule.</span>
7 0
3 years ago
What is a string of nucleotides called?
Soloha48 [4]
A string of nucleotides that hold information is called a gene. :)
3 0
3 years ago
Read 2 more answers
The ____ is a subcortical structure that participates in the regulation of thirst, temperature, hunger, sexual behavior, and agg
SVEN [57.7K]

Answer:

Hypothalamus

Explanation:

The Hypothalamus is located below the cerebral cortex. It's involved with basic functions like eating, sex, temperature control, sleep, aggression. It's main function is to produce sex, growth and stress related hormones carried down axons to the pituitary gland. When carried out, it's then released into the bloodstream to activate and organize distant body systems.

6 0
3 years ago
Gaps in the myelin sheath are called A. synapses. B. nodes of Ranvier. C. interaxons. D. ganglia.
Annette [7]
Most likely synapses because it’s gaps
6 0
3 years ago
Other questions:
  • Connective tissue that specializes in the storage of fat
    8·1 answer
  • What are the parts of a seed? Check all that apply.
    15·1 answer
  • What is all the organisms living in a certain area?
    7·2 answers
  • When observations, over time, repeatedly support an assumption, the assumption comes to be known as a principle true or false
    6·1 answer
  • you should describe the events and changes that happen to you and your friends as you journey through the light independent reac
    9·1 answer
  • What is the hottest water a person can stand?
    12·1 answer
  • If there is a disease that has to do with oxygen/carbon dioxide exchange, where is the issue?
    7·1 answer
  • Which name is given to this<br> tough shell made of protein
    5·2 answers
  • The mineral magnetite is generally black or dark gray, with a metallic luster.
    10·1 answer
  • Chalify the relationship between cells,tissue,organ and system with an example​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!