1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lena [83]
3 years ago
6

Type your response in the box. The sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, wha

t should the nucleotides on the other strand be? Start with the top of the strand and work down
Biology
2 answers:
Marianna [84]3 years ago
5 0

Answer:

The correct answer is- TAAGCCGATAAATGCTAACGGTA.

Explanation:

DNA is a nucleic acid molecule made of two strands. Each strand is made up of nucleotide bonded via phosphodiester bonds. Each nucleotide is made up of- 5C deoxyribose sugar, a phosphate group and nitrogenous bases.  

DNA replication produces an exact copy of the DNA molecule through complementary base pairing. The complementary strand is formed by adding nucleotide through DNA polymerase which adds base pairs according to the Chargaff rule.  The Chargaff rule states that A will bind T via two hydrogen bonds and G will bind C via three hydrogen bonds.

Therefore, the complementary strand will be-TAAGCCGATAAATGCTAACGGTA

Sedaia [141]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Just had it on a quiz, got it right.

You might be interested in
The earth's interior heat and pressure drive a process of heat transfer in the mantle called blank
xxMikexx [17]
The answer should be B Convection
6 0
4 years ago
What is the smallest bone in the human body
kherson [118]
The smallest bone in the human body is the stapes bone, located in the ear.
Hope that helped you.
5 0
3 years ago
Read 2 more answers
Some people have one sickle cell gene and one normal gene. They have few defective cells and no symptoms because the sickle cell
VladimirAG [237]

Answer:

Explanation:During fertilization the embryo receives half of its genetic information from both parents. If one parent is a carrier or sickle cell their genes would be Aa little a being the recessive gene. When mixed with the other parents gene who does not have sickle cell their genes would be AA. When you make a pun net square the results would be AA,AA,Aa,and Aa. Therefore the offspring would have a 50% chance of being a carrier of sickle cell but not having the actual disease

7 0
4 years ago
Which structure could be found in both a prokaryotic cell and a eukaryotic cell?
nevsk [136]

Both cells have ribosomes, cytoplams and DNA, but the ribosomes are the structures that can be found in both cells.

6 0
3 years ago
Read 2 more answers
During which part of pregnancy does the fetus begin to blink its eyes and become more active
Nikolay [14]

The answer is In the last trimester of pregnancy. While the senses of the fetus start to develop in the 8th week, the different sense mature at different stages. Vision is the last sense to mature. After the 26th week, after the eyelids of the fetus have fully developed, the fetus begins to blink (even experience REM while involves rapid eyelid movements ).






6 0
3 years ago
Other questions:
  • Regions of fetal cartilage that ossify into bone tissue prior to birth are called
    8·2 answers
  • A woman is training to improve her running capabilities for an upcoming marathon. She is progressively increasing the distance a
    12·1 answer
  • The diagram below shows a material being cycled between the living and nonliving environments.
    14·1 answer
  • What are animals ribs made from
    9·2 answers
  • What are the main functions of the skeletal system?
    13·1 answer
  • What is the outcome when a cell undergoes meiosis
    15·2 answers
  • Keeling began measuring tropospheric carbon dioxide concentrations at Mauna Loa observatory in Hawaii in 1958. This is a remote
    9·1 answer
  • Select all of the following that are true about rain that falls on deserts:
    12·2 answers
  • 8. Which of the following organ systems function like a cell membrane in animal cells
    15·2 answers
  • How do plants transport these micronutrients to the reproductive tissues (tissue)?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!