1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lena [83]
3 years ago
6

Type your response in the box. The sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, wha

t should the nucleotides on the other strand be? Start with the top of the strand and work down
Biology
2 answers:
Marianna [84]3 years ago
5 0

Answer:

The correct answer is- TAAGCCGATAAATGCTAACGGTA.

Explanation:

DNA is a nucleic acid molecule made of two strands. Each strand is made up of nucleotide bonded via phosphodiester bonds. Each nucleotide is made up of- 5C deoxyribose sugar, a phosphate group and nitrogenous bases.  

DNA replication produces an exact copy of the DNA molecule through complementary base pairing. The complementary strand is formed by adding nucleotide through DNA polymerase which adds base pairs according to the Chargaff rule.  The Chargaff rule states that A will bind T via two hydrogen bonds and G will bind C via three hydrogen bonds.

Therefore, the complementary strand will be-TAAGCCGATAAATGCTAACGGTA

Sedaia [141]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Just had it on a quiz, got it right.

You might be interested in
Why do we say we have “about 200 moons” in our solar system?
Ket [755]

Answer:Our solar system consists of our star, the Sun, and everything bound to it by gravity — the planets Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus and Neptune, dwarf planets such as Pluto, dozens of moons and millions of asteroids, comets and meteoroids. Beyond our own solar system, we have discovered thousands of planetary systems orbiting other stars in the Milky Way.

Explanation: he planets of our solar system—and even some asteroids—hold more than 150 moons in their orbits.

5 0
3 years ago
In studying layers of rock, which statement is normally true?
kotykmax [81]
Should be A the newer layers are usually on top
4 0
3 years ago
When particles spread out it is called
nadezda [96]

When particles spread out it is called diffusion.

5 0
3 years ago
By what method is water added to the atmosphere
satela [25.4K]
Evaporation or transpiration (a type of evaporation)
5 0
3 years ago
Compare the general appearance of the DNA molecule with the mRNA molecule.
HACTEHA [7]

Answer:

Between DNA and RNA

Explanation:

the molecules un wind

4 0
2 years ago
Other questions:
  • Construct a food chain consisting of at least three organisms, including a producer,
    9·1 answer
  • Monoploid gametes are produced in animal cell as of what
    14·1 answer
  • The same amino acid can be carried by different tRNA's.<br><br><br><br><br> true or false
    9·2 answers
  • Cells contain specialized parts known as organelles. These specialized parts perform very specific functions within cells. For e
    14·2 answers
  • Help please bc I don't really know so yea
    10·1 answer
  • A 6-month-old vaccinated infant arrives in the ED with a 12-hour history of poor feeding, emesis, and irritability. On exam, she
    15·2 answers
  • The typical characteristics for binge-eating disorder include binge-eating episodes
    14·1 answer
  • (GIVING BRAINLIEST!!!!)
    6·1 answer
  • Which of the following would be most negatively impacted by the use of DNAse, an enzyme that breaks down
    14·1 answer
  • Why is farming bad for the society?? Please use simple words
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!