1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lena [83]
3 years ago
6

Type your response in the box. The sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, wha

t should the nucleotides on the other strand be? Start with the top of the strand and work down
Biology
2 answers:
Marianna [84]3 years ago
5 0

Answer:

The correct answer is- TAAGCCGATAAATGCTAACGGTA.

Explanation:

DNA is a nucleic acid molecule made of two strands. Each strand is made up of nucleotide bonded via phosphodiester bonds. Each nucleotide is made up of- 5C deoxyribose sugar, a phosphate group and nitrogenous bases.  

DNA replication produces an exact copy of the DNA molecule through complementary base pairing. The complementary strand is formed by adding nucleotide through DNA polymerase which adds base pairs according to the Chargaff rule.  The Chargaff rule states that A will bind T via two hydrogen bonds and G will bind C via three hydrogen bonds.

Therefore, the complementary strand will be-TAAGCCGATAAATGCTAACGGTA

Sedaia [141]3 years ago
3 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Just had it on a quiz, got it right.

You might be interested in
Please help me on this question
Marina86 [1]

Answer:

yes, it got better, because the sharks won't eat them.

Explanation:

3 0
3 years ago
Name three adaptations that helped plants survive on land, and describe how each of them helped.
Blizzard [7]
Embryo retention, a cuticle, stomata, and vascular tissue. Hope this helps!
7 0
3 years ago
What group of people study or research carbon footprints??
xxMikexx [17]

Answer:

The study by Jones and RAEL director Daniel Kammen, a UC Berkeley

Explanation:

Hope this helps!

3 0
3 years ago
Read 2 more answers
Hello please help i’ll give brainliest
saveliy_v [14]

Answer: Clastic sedimentary rocks are made up of pieces (clasts) of pre-existing rocks. Pieces of rock are loosened by weathering, then transported to some basin or depression where sediment is trapped. If the sediment is buried deeply, it becomes compacted and cemented, forming sedimentary rock.

Explanation:

5 0
3 years ago
What is a galaxy?
alukav5142 [94]

Answer:

The answer to the question is D

8 0
3 years ago
Other questions:
  • another Punnett square that shows a cross between a heterozygous red bull (Rr) and a heterozygous red cow (Rr). Determine the ra
    5·2 answers
  • The world's population:
    11·1 answer
  • Plz help don’t get was not at school
    6·1 answer
  • How are diseases caused?
    8·1 answer
  • Choose all the answers that apply.
    9·2 answers
  • WORLD POPULATION GROWTH
    9·1 answer
  • When free energy is released during a chemical reaction it is called what of below
    12·1 answer
  • Important test and i have limited time so please hurry <3
    8·2 answers
  • Which statement is the best decription of how blood circulates through the body?
    6·1 answer
  • Which of the following best describes sickle-cell anemia?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!