1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lerok [7]
3 years ago
11

Which of the following is true about the speed of light?

Biology
1 answer:
Arte-miy333 [17]3 years ago
7 0

Answer:

<em>It is a constant when the light is traveling in a vacuum.</em>

Explanation:

You might be interested in
The effects of epinephrine are typically observed within
Galina-37 [17]

Answer:

70mins

Explanation:

i don't have one I just know

8 0
3 years ago
Please help very easy 5th grade work giving brainliest
strojnjashka [21]

Answer:

pretty sure its A hope this helps!

8 0
3 years ago
Read 2 more answers
How does natural selection lead to evolution?
Romashka-Z-Leto [24]
I believe that the answer is B.
3 0
3 years ago
Read 2 more answers
What part of your brain tells yoh that your hungry?
Bad White [126]
You'r <span> Hypothalamus partially controls your hunger!
Happy to assist!</span>
7 0
3 years ago
Ask this please…………..
tamaranim1 [39]

Answer:

maybe A:

Explanation:

4 0
3 years ago
Other questions:
  • Which elevation zone on the image above is best suited for growing bananas and sugarcane?
    5·2 answers
  • Describe one of the many paths a carbon molecule can take through the carbon cycle.
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Explain what the interviewer meant when he said that genetic mutations are like misprints in a book.
    15·1 answer
  • What's the difference between a TEM microscope and a SEM microscope? Please explain in detail.
    14·1 answer
  • Which statements are accurate about earthquakes that occur during the formation of a chain of islands and seamounts by a hotspot
    5·1 answer
  • what is the function of vesicles in the synthesis of proteins and the release or those proteins outside the cell?
    12·1 answer
  • Which outcome is the main function of the light dependent reaction‘s of photosynthesis
    15·1 answer
  • The only phylum that shows active flight in invertebrates is
    9·1 answer
  • Can anyone help me with this please​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!