1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorLugansk [536]
4 years ago
15

Why is it necessary for the DNA to make a copy of itse

Biology
1 answer:
spin [16.1K]4 years ago
6 0

DNA is a huge molecule with lakhs of genes. At time of protein synthesis, only one or a few genes are needed which is very difficult to synthesize directly from that huge molecule.

Secondly, DNA is a very important molecule, which remains inside nucleus. All the protein synthesizing elements like amino acids etc are present in cytoplasm. So protein synthesis inside nucleus is impossible.

<h3><u>Explanation:</u></h3>

DNA is the genetic molecule of an organism. It is a huge polymer of different nucleotides stacked together one after the other. One gene occupies a very small fragment of this DNA. So during protein synthesis, if protein is directly synthesized from the whole DNA, a huge portion of energy will be lost fully unwinding the helical structure. And there will be more chances of an error and mutations will creep in very easily.

Secondly, DNA remains inside the nucleus of a cell. And inside the nucleus there's no entry of amino acids, which are essentially needed for protein synthesis. So protein synthesis from DNA is very risky and practically not feasible.

You might be interested in
Each enzyme produced by the body is
yuradex [85]
I think the correct answer from the choices listed above is option A. Each enzyme produced by the body is specific which means it is only able to catalyze a reaction with a certain molecule. Hope this answers the question. Have a nice day.
8 1
4 years ago
Read 2 more answers
Discuss efficiency of skin as a barrier
GREYUIT [131]

Answer:

The skin prevents pathogens from entering our body. It covers almost all parts of our bodies and if we get a cut, the skin will begin to heal itself so no bacteria can get into our bodies and cause infections.

Explanation:

5 0
3 years ago
Chlorophyll is the primary pigment in plant chloroplasts. It absorbs all wavelengths of light, EXCEPT ____________.
photoshop1234 [79]
Green. It reflects it, that's why se see plants as green
4 0
3 years ago
-----------------------------
Molodets [167]

Answer:

....

Explanation:

4 0
3 years ago
Pls, I need help with this! Biology Thank you :)
topjm [15]

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

8 0
3 years ago
Other questions:
  • Which of the following best describes the trend represented by this graph?
    5·1 answer
  • The interaction between DNA and histone proteins (forming nucleosomes) plays a key role in the regulation of gene expression in
    5·1 answer
  • The element nitrogen has the atomic number seven and an atomic mass of 14 how many neutrons does an atom of nitrogen contain
    6·1 answer
  • The perimeter is<br>2/3 +3/4 +2/3 +3/4
    12·1 answer
  • One unique anatomical feature of cardiac muscle is A. cylindrical myofibrils. B. intercalated disks. C. sarcosomes. D. dense bod
    8·1 answer
  • A white-flowered plant is crossed with a red-flowered plant, and all of the offspring have pink flowers. this could be an exampl
    11·1 answer
  • Which two monomers may combine to form a polyester?
    6·2 answers
  • How does biodiversity affect ecosystem stability?
    15·1 answer
  • How can accidental transfer of DNA impact a crime scene investigation? In addition, explain why accidental DNA transfer cannot b
    11·1 answer
  • Scientific Method
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!