1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
avanturin [10]
3 years ago
14

Which level of organization is the largest?

Biology
1 answer:
Anni [7]3 years ago
3 0
The first one is domain
You might be interested in
Describe the process of transcription and where it happens. Using the starting code AGATTGACA
andrezito [222]

If it’s DNA than the transcription is TCTAACTGT

If it’s RNA than it’s UCUAACUGU

5 0
3 years ago
Which important biochemical process receives a supply of NAD+ ions from the fermentation process during anaerobic respiration?
sammy [17]

Answer:

Glycolysis.

Explanation:

Glycolysis is a universal process that provides energy in the form of ATP molecules. It requires two molecules of NAD+, which are reduced to NADH during glycolysis. Thus, regeneration of NAD+ is necessary as if NAD+ is absent, glycolysis cannot be able to continue.

During anaerobic respiration (respiration in the absence of oxygen), fermentation takes place to regenerate NAD+ used in the process of glycolysis.  

6 0
3 years ago
Read 2 more answers
The _____ theory explains how our universe became so structured and uniform.
Georgia [21]
<span>Inflation theory is the theory explains why our universe is structured and uniform and suggests that the universe is flat in shape. According to that theory, the universe expanded exponentially fast for a fraction of a second after the Big Bang.</span>
8 0
3 years ago
Read 2 more answers
What is meant by the phrase Dark side of the moon
marshall27 [118]
The portion of the Moon's surface that cannot be directly observed from Earth
3 0
3 years ago
Read 2 more answers
Two species of spiny mice compete for the same food source. One species of spiny mice feeds on insects during the day, while a s
Mandarinka [93]

Answer:

resource partitioning

Explanation:

Based on the scenario being described within the question it can be said that this is an example of resource partitioning. This term refers to when a species divides the limited resources in order to avoid competition within it's environment. Such as the two species of mice are doing by feeding in on the same resources at different times in order to avoid competition and conflict between each other. Thus allowing them to co-exist within the same environment.

3 0
3 years ago
Other questions:
  • Which process added new genes to a gene pool?
    14·1 answer
  • How many more phases occur during meiosis than during mitosis?<br> none<br> two<br> four<br> six
    7·2 answers
  • If the length of a helper t-cell is 20 micrometers calculate the approximate size of a HIV virus
    9·1 answer
  • Which spheres are represented when fossil form?
    13·1 answer
  • Where does chemiosmosis occur?
    12·2 answers
  • What structure is part of an echinoderms water vascular system?
    6·1 answer
  • Burning fossil fuels for energy releases harmful emissions into the air. Which health concern is most likely related to these em
    8·2 answers
  • Please only respond if you can help or know answers
    8·2 answers
  • What order allows animals to get usable fuel from the sun? multiple chose
    14·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!