1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masja [62]
3 years ago
5

What is the meaning of biology?

Biology
1 answer:
Luda [366]3 years ago
6 0

Answer:

the study of living organisms, divided into many specialized fields that cover their morphology, physiology, anatomy, behavior, origin, and distribution.

Explanation:

mark me brainiest '-'

You might be interested in
Soil erosion is a process where the top soil layer is washed away because of the effects of water or wind. An agricultural area
abruzzese [7]

Answer:

add plants and trees

Explanation:

they help hold the soil in place because of their roots

8 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
A reproduction of a cell for growth and division occurs in very specific stages and in a specific order. The cell in Figure 9 -
Virty [35]
Answer: Prophase

Do check if the answer’s correct, it’s been long since I’ve looked into the stages.
6 0
2 years ago
Giving brainliest!!!!!!!
Alex

Answer:

Explanation:

Hope this helps

5 0
3 years ago
Read 2 more answers
Aristo was riding in a car and noticed a pond that was covered in algal blooms. Which of these other features in the landscape c
solniwko [45]
The question doesn't have choices. It would be better to have one.
6 0
3 years ago
Read 2 more answers
Other questions:
  • The Cell Cycle:
    8·1 answer
  • In ancient times, scientists believed that matter could be destroyed by burning or breaking. Modern scientists believe that matt
    14·2 answers
  • Wave energy is a type of ocean based renewable energy source that uses the power of the waves to generate electricity. Where is
    6·1 answer
  • Look at the table on the right. Which of these two organisms are most closely related? Brown rat and Eastern cottontail rabbit B
    15·2 answers
  • Voice pitch is an inherited trait. Which family group is most likely to occur?
    7·1 answer
  • Select all that apply. Which of the following are parts of a desert community? jack rabbit plankton beaver cactus crayfish
    9·1 answer
  • The genetic molecule common to all living things is
    5·1 answer
  • Durante la expresión génica, el ADN se transcribe en ARN en el núcleo. Luego, el ARN se traduce en proteínas en el citoplasma. ¿
    14·1 answer
  • PLEASE HELP! WILL MARK BRANLIEST!
    15·1 answer
  • How is the phloem in a leaf related to the roots of the plant?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!