1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seraphim [82]
3 years ago
6

Which of the following is an example of human capital?

Biology
1 answer:
chubhunter [2.5K]3 years ago
6 0

The investment in education and training for people.

You might be interested in
Paula is a middle-aged doctor who is an expert at laser eye surgery for the correction of myopia (nearsightedness). she graduate
Serga [27]
<span>Paula, because she has performed the operation very often and now she possesses the ability to perform the operation more strategically and flexibly. Also because she has 35 years of experience should reduce such other negative factors such as complications during procedure.</span>
7 0
2 years ago
What happens during interphase?<br> Apex
Ganezh [65]

Answer AND Explanation:

In spite being called the resting phase, many cellular processes take place during this phase. One of the most important of these is chromosomal replication in which each chromosome produces an exact copy of itself. The chromosomes are not visible as discrete structures but instead they appear as diffuse tangle of threads called chromatin.

Another important event is the formation of new organelles like mitochondria. There is also a build up of energy stores which is necessary to drive the mitotic process.

4 0
2 years ago
Read 2 more answers
All living organisms break down sugar to obtain energy using cellular respiration, Which of the following chemical reactions rep
Ghella [55]

Answer:

The chemical reaction that represents the process of aerobic cell respiration is oxygen + glucose → water + carbon dioxide + energy

Explanation:

Cell respiration occurs in the mitochondria of eukaryotic cells and consists of a series of chemical reactions in which energy in the form of ATP molecules is obtained from a glucose molecule in the presence of oxygen.

<u>Glucose is the main energetic substrate</u> to be able to synthesize energy in the form of ATP, through oxidative phosphorylation. At the end of the process ATP is obtained as products, and as waste compounds water and carbon dioxide, which can be schematized in the following chemical reaction:

              <em>              C₆H₁₂O₆  +  6O₂ →  6H₂O  +  6CO₂ + ATP ↑</em>

<em>                Glucose + Oxygen → Water + Carbon dioxide + Energy ↑</em>

This reaction summarizes what happens in aerobic cellular breathing, which is necessary to synthesize energy for cellular functions.

The other reactions:

  • <em>oxygen + water </em><em>→</em><em> glucose + lactose </em>
  • <em>glucose + lactose </em><em>→</em><em> oxygen + water </em>
  • <em>water + carbon dioxide + energy </em><em>→</em><em> oxygen + glucose</em>

<em>do not represent the components or the order of the reactions that occur in aerobic cell respiration</em>

7 0
2 years ago
A biome is defined by it
elena55 [62]
Biomes are typically defined<span> by their climate and dominant vegetation, including grassland, tundra, desert, tropical rainforest, and deciduous and coniferous forests.</span>
7 0
3 years ago
The best source of internal motivation is from
dybincka [34]
<span>positive self talk is the best source of internal motivation.</span>
3 0
3 years ago
Other questions:
  • Uman monozygotic (identical) twins are produced when a developing embryo splits in
    8·1 answer
  • An atom with how many electrons in its outer shell is most stable? A) 1 B)4 c) 8 or d) 10
    6·1 answer
  • I couldn't understand what point 8 meant at all, what does that actually say
    12·1 answer
  • Which of the following types of information is most closely associated with the concept of "Labeled Line Code."
    8·1 answer
  • The light from a laser must be reflected before we can see it TRUE OR FALSE
    15·1 answer
  • BLANK structures are fully functional, show evidence of a common ancestor, and may or may not
    15·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • A scientist is studying a cell from an unidentified organism. Which of these observations of the cell provide evidence for class
    14·1 answer
  • 1 point
    7·1 answer
  • What determines cell differentiation once gene regulation has taken place?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!