1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadya68 [22]
3 years ago
10

Sparrows with average-sized wings survive severe storms better than those with longer or shorter wings, illustrating

Biology
1 answer:
Artyom0805 [142]3 years ago
6 0

Answer:

The correct answer is option B) "stabilizing selection".

Explanation:

Stabilizing selection is a type of natural selection at which mean traits are favored by nature instead of extreme values. In this case at which sparrows with average-sized wings survive severe storms better than those with longer or shorter wings illustrates stabilizing selection. It its believed that this type of selection is the most commonly found in nature, since most traits have no extreme values in most of the species.

You might be interested in
Which two main processes take place to produce proteins?
Sophie [7]

the two main processes are: transcription and translation

6 0
3 years ago
Read 2 more answers
Which organism is most closely related to the house cat?
marshall27 [118]
The answer would be Felis silvestris lybica
3 0
3 years ago
A trait that can mask another trait is known as a
ludmilkaskok [199]
A trait that can mask another trait is known as a dominant trait.
3 0
3 years ago
Why drugs prevent the reflex act<br> ion from occuring should be avoided
love history [14]

Answer:

Hope this helps! :)

8 0
3 years ago
Both starch and cellulose are glucose polymers. why can animals easily degrade starch, but not cellulose?
Rus_ich [418]
Human bodies contain enzymes that can break down starch into glucose and use it for fuel. We do not have the enzymes necessary to breakdown cellulose.
4 0
3 years ago
Other questions:
  • What dinosaur is found on almost every continent?
    8·2 answers
  • Please help , thank you :)
    11·1 answer
  • Which characteristic distinguishes the five groups of fungi?
    6·1 answer
  • Which means of particle transport is shown in Figure 7–4 above?
    5·2 answers
  • 1. Which statement about the current U.S. Supreme
    14·1 answer
  • Will mark brainlisest!<br><br>How are neurons connected <br><br>Just one sentence answer thx
    8·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Identify the characteristics of a leaf that make it a good tool for photosynthesis. Explain your answer.
    6·2 answers
  • B2 Cell division
    15·1 answer
  • do daily fluctuations in inhibitory control predict alcohol consumption? an ecological momentary assessment study
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!