1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serga [27]
3 years ago
9

The structure (elements) of a Nucleic Acid is a​

Biology
2 answers:
frutty [35]3 years ago
8 0

Explanation:

Basic structure polynucleotides

spayn [35]3 years ago
3 0

Answer:

a 5-carbon sugar, a phosphate group and a nitrogenous base.

You might be interested in
If an object is placed an electric field how will it move
Vaselesa [24]

Answer:

Explanation:

Electric field is a vector quantity whose direction is defined as the direction that a positive test charge would be pushed when placed in the field. Thus, the electric field direction about a positive source charge is always directed away from the positive source.

3 0
2 years ago
g Electron flow down the electron-transport chain leads to the transport of proteins: Group of answer choices from the matrix to
guajiro [1.7K]

Answer:

from the intermembrane space to the matrix

Explanation:

In the electron transport chain (ETC), electrons flow from one protein complex to another. However, as this electrons are transfered, protons (H+) is built up from the intermembrane space of the mitochondria to the mitochondrial matrix.

Hence, according to this question, a proton gradient is formed when hydrogen ions (H+) are moving from the intermembrane space to the matrix of the mitochondrial.

5 0
3 years ago
Why do developing countries experience greater growth?
MAVERICK [17]

Because since developing countries are still growing, when they finally get to the level of some more advanced countries the country as a whole feels a "greater growth"

8 0
3 years ago
Read 3 more answers
Why would plants have pigments that are not photosynthetically active
QveST [7]
Pigments absorb light used in photosynthesis.Set of wavelengths that a pigment doesn't absorb are reflected.
3 0
3 years ago
Telescopes make things bigger and microscopes make things smaller.<br><br> True<br><br><br> False
aev [14]

Answer:

false

Explanation:

a microscope is used to enhance small objects like cells.

7 0
3 years ago
Other questions:
  • What stress threatens tissues
    14·1 answer
  • What can affect the properties of substance?
    14·2 answers
  • Fur color is an inherited trait controlled by one pair of alleles where one form is dominant over the other. The fur color is ei
    11·1 answer
  • What sense organs are located on the head and in the mouth of a pig?
    7·1 answer
  • Complete the new strand of DNA off of the old strand of DNA.
    10·1 answer
  • Acceleration is equal to the initial velocity minus the final velocity, then divided by time.
    10·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • How are nonmetals identified?
    10·2 answers
  • Besides, Organelles, Similar membranes and that they both have eukaryotic cells how are plant cells and animal cells alike?
    8·2 answers
  • Ozone depletion:
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!