1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kazeer [188]
3 years ago
13

10 POINTS

Biology
1 answer:
Alex73 [517]3 years ago
5 0

Answer:

A  natural selection

D Plate techtonics

Explanation:

Movement of the plates over Earth’s surface is termed plate tectonics. Plates move at a rate of a few centimeters a year, about the same rate fingernails grow.

The idea that organisms can evolve by micro and macro evolution is a fact. However there is no definite factor to what produces evolution.

Natural Selection is a theory because it is backed by observable evidence but is not considered the definite cause as to why organisms can evolve due to surrounding debate

You might be interested in
Leaves have air spaces to allow for carbon dioxide and oxygen to move into and out of cells for photosynthesis, which causes wat
geniusboy [140]

Answer:

They have  helical thickening of lignin in their walls to prevent collapse

Explanation:

the primary function of Xylem and its conducting vessels tracheids is to provide  support and tranport  water and  minerals  in plants.

Xylem vessels  have layers of dead materials in the walls called LIGNIN.   Lignin is a polymer; a  very strong, hard materials that stop water passage  through it,because it contains dead cells,

Therefore  the presence of  deposit of these strong  impermeable, ligified  walls  in its  walls  prevent its collapse during mass flow of water of transpiration pull.

6 0
3 years ago
Although mining Is dangerous what advantage does coal have over other types of energy
ArbitrLikvidat [17]

Answer:

energy reduced fired plants

Explanation:

energy produced from coal fired plants is cheaper and more affordable than other energy sources

3 0
3 years ago
Read 2 more answers
AYUDAAA
Lemur [1.5K]

Answer:

11)El ciclo del agua, conocido científicamente como ciclo hidrológico, se refiere al intercambio continuo de agua en la hidrosfera, entre la atmósfera, el agua del suelo, la superficie, el agua subterránea y las plantas. La ciencia que estudia el ciclo hidrológico es la hidrología.

12)Sabems que las etapas del ciclo hidrológico  son las siguientes:

Evaporación

Condensación

Precipitación.

Las implicaciones que tienen para la vida cada una de las etapas son:

Evaporación, se reduce el nivel de los ríos, los lagos pequeños se seca, y se eleva la temperatura del ambiente.

Condensación, Es el proceso en el cual se forman las nubes, por lo que la luz solar disminuye.

Precipitación, produce nuevamente el aumento de los niveles de rios y lagos, y la disminución de la temperatura.

Explanation:

5 0
2 years ago
Which biomolecule does RNA and DNA belong to
ratelena [41]

Answer:

Nucleic acids

Explanation:

Nucleic acids are the biopolymers, or small biomolecules, essential to all known forms of life. The term nucleic acid is the overall name for DNA and RNA.

4 0
2 years ago
The sleep like state which an animal adopt to lower metabolic rates is called
vivado [14]
Heyy :))

The best answer would be:
<span>Hibernating

I hope this helps!
Good day :D</span>
3 0
3 years ago
Other questions:
  • Which microscope would be most useful for quickly estimating the number of red blood cells in a patients blood sample
    7·2 answers
  • What is one difference between a cell wall and a cell membrane?
    15·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Select the item that is NOT a common pathogen. 1.) Salmonella 2.) Typhoonosis 3.) Staphylococcus aureus 4.) Listeria
    12·1 answer
  • Does anyone have the final exam answers for marine science?
    9·1 answer
  • Explain what happens to tissues, such as the heart, or the brain, if oxygenated blood is not delivered in a timely manner.
    5·1 answer
  • ( 10 points) (pls help brainliest)
    15·2 answers
  • What is the role of oxygen in photosynthesis and in cellular respiration?
    13·2 answers
  • Please tell me the differences between a compound and a simple leaf. 5 differences if possible.
    15·1 answer
  • Question: Why do you deserve this scholarship? ...
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!