1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natta225 [31]
3 years ago
11

There is a theory that gravity could pull galaxies back together, causing a reverse big bang.

Biology
2 answers:
Rashid [163]3 years ago
8 0

Answer: The expansion of the universe is accelerating.

Explanation: Every millisecond the expansion slowly but surely speeds up.

Ede4ka [16]3 years ago
4 0

Answer:

I would say A: "Background radiation is present.

Explanation:

B, C, and D are proving that the universe is still expanding to this very second, the faster the universe expands the bigger it gets (obviously). Gas giants forming farther away from the Sun, once again, shows that the universe is expanding, and the same thing applies with B.

You might be interested in
Which greenhouse gas has an average lifetime in the atmosphere of a few weeks to thousands of years?
Mekhanik [1.2K]

Due to human activities, the greenhouse gases are the most substantial mediator of the witnessed climate change since the mid-20th century. Globally, the overall emissions of greenhouse gases due to human activities have upsurged by 35 % from 1990 to 2010.  

The concentrations of carbon dioxide and other greenhouse gases in the atmosphere have upsurged since the start of the industrial revolution. Of the greenhouse gases, the fluorinated gases exhibit an average lifetime in the atmosphere of a few weeks to thousands of years.  

The fluorinated gases refer to an array of gases, which comprise fluorine, incorporating perfluorocarbons, hydrofluorocarbons, and sulfur hexafluoride, among other chemicals.  

These gases are discharged due to numerous industrial procedures and household and commercial applications and do not take place naturally. It is at certain instances used as the substitutes for the ozone-depleting components like CFCs.  


6 0
3 years ago
Read 2 more answers
Question 6 Which statement BEST describes the relationship between photosynthesis and cellular respiration? A Both processes rel
mixer [17]

Answer:

c. The products of one process are the reactants of the other process

Explanation:

CARBOHYDRATE and oxygen  is the product of photosynthesis while it is reactant in respiration.

Similarly, Carbon dioxide is the reactant of photosynthesis while it is product of respiration.

3 0
3 years ago
Explain the logic the woodcutter uses to justify cutting some of the trees for our use.
Y_Kistochka [10]
A woodcutter could justify cutting trees for use say in a pioneering situation whereby the pioneer needs shelter and food so trees could be necessary to say construct a small log cabin and table for eating/preparing food at to ensure the survival of the pioneer. 
7 0
3 years ago
What is acid rain and how is it a problem to oceans, rivers, lakes, ponds, etc.
amid [387]

Answer:

Any form of precipitation like rain, snow, fog, hail, and even dust that has acidic components. When the acidity of a lake  increases, the water becomes clearer and the all the animals decrease.

Explanation:

4 0
3 years ago
Describe geographical isolation and competition
zmey [24]
Geographical isolation usually refers to <span>two populations of the same species being separated due to some type of physical barrier. This separation of population </span>occurs<span> when a body of water or land forms and divides a habitat. </span>Geographic isolation<span> of a species also can </span>occur<span> when animals migrate to an isolated island.</span>
3 0
4 years ago
Other questions:
  • Describe the process of photosynthesis and cellular respiration<br><br> (not too long)
    15·1 answer
  • The fundamental excitable cell in the nervous system is the _____. see concept 49.1 (page 1084)
    10·1 answer
  • In the skeletal muscle cells of vertebrates, as many as ____________ molecules of atp are produced from one molecule of glucose.
    14·2 answers
  • How is mass affected by the location of an object in space?
    5·1 answer
  • What type of macromolecule is hemoglobin and whats its function in mammals?
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What needs to be in order for something to be scientific?
    13·1 answer
  • What is the primary difference between prokaryotic and eukaryotic cells?
    13·1 answer
  • Which of the following are the possible allele combinations from the gametes of an organism with the genotype of AaBb?
    11·2 answers
  • Define dark reaction​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!