1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anni [7]
3 years ago
9

If there was a sudden drop in temperature after the evolution of the first living cells, predict how that might have affected th

e changes in the atmosphere and the evolution of cyanobacteria and other autotrophs.
Biology
1 answer:
fgiga [73]3 years ago
8 0
If there was a sudden drop in temperature after the evolution of the first living cells, the rate of fermentation would drop due to the temperature. My prediction would have to include the data, which is on the graph. The question does not include a temperature to base my hypothesis on so I would have to conclude that if the temperature suddenly dropped to 35ºC to -20ºC, that the initial cells would die, and that the atmosphere and the evolution of cyanobacteria would change drastically.
You might be interested in
I need help yahll guys
ArbitrLikvidat [17]

Answer: a.

Explanation: because i got it right on a test i had

3 0
3 years ago
PLEASE ANSWER ASAP
adoni [48]

1 : D

2 : A

3 : D

4 : C

5 : B

4 0
3 years ago
Read 2 more answers
. When an animal is thirsty, it responds by -
frez [133]

when an animal is thirsty, it responds by drinking water

6 0
3 years ago
Which of the following describe smooth muscle tissue?a. Uninucleate, nonstriatedb. Multinucleate, striatedc. Multinucleate, nons
Blababa [14]

Answer:

a. Uninucleate, nonstriated

Explanation:

Smooth muscle tissue is composed of smooth muscle cells that are spindle-shaped with a single nucleus. Smooth muscles line the walls of hollow organs such as urinary bladder, uterus, stomach, intestines but also arteries and veins and the tracts of the respiratory, and reproductive systems. Smooth muscles are under involuntary control, meaning that their contraction is unconscious.

6 0
3 years ago
Red-green color blindness is an X-linked recessive disorder that is passed through generations and can be traced by using a pedi
Nostrana [21]

Answer:

Lisa and Monica

Explanation:

<em>The correct answer would be Lisa and Monica.</em>

<u>For X-linked recessive disorders, a female can be unaffected, a carrier, or affected. However, a male can either be affected or unaffected and never a carrier. This is because females have two X chromosomes while males have only one.</u>

In addition, completely filled-in shapes in a pedigree mean that such individuals are affected for the trait in question while half-filled shapes mean the individuals are carriers for the trait.

Hence, individuals in the pedigree that are labeled carriers for red-green color blindness are Lisa and Monica (they both have half-filled shapes).

8 0
3 years ago
Read 2 more answers
Other questions:
  • A scientist is studying an aquarium ecosystem that contains water, plants, and fish that eat those plants. The aquarium has glas
    15·2 answers
  • DNA fragments show up as a series of different sized ______.
    9·1 answer
  • What is the density of a liquid that has a volume of 20 mL and a mass of 3 g?
    5·1 answer
  • Match each organism with its phylum Pines Ephedra Palm-like plants Trees with fan-shaped leaves A. Gnetophyta B. Ginkgophyta C.
    8·1 answer
  • The absolute threshold for human vision is the ability to see a candle from _______ miles away on a dark night.
    11·1 answer
  • How many atoms in the compound 5NH4cI
    7·1 answer
  • I WILL GIVE BRAINLIEST!!!
    8·2 answers
  • What is the optimal temperature for photosynthesis?
    8·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which statement explains blood pressure?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!