1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
3 years ago
11

In the food web picture, squirrels would be classified as ? is it

Biology
1 answer:
professor190 [17]3 years ago
6 0

Answer:

Omnivore

Explanation:

Squirrels mainly eat fungi, seeds, nuts and fruits, but they will also munch on eggs, small insects, caterpillars, small animals and even young snakes.

You might be interested in
What body systems are damaged by a sprained ankle?
julsineya [31]
Blood vessels, ligaments, muscles, and skin pigment.
8 0
3 years ago
2. What evidence was found to support the different parts of cell theory?
lukranit [14]

Answer:

The invention of the electron microscope allowed them to see organelles and other structures smaller than cells. There is variation in cells, but all cells have a plasma membrane, cytoplasm, ribosomes, and DNA. These similarities show that all life on Earth has a common ancestor in the distant past

4 0
3 years ago
The earth is composed of three different chemical layers: core, mantle, and crust. This layering effect is called _____.
almond37 [142]

Answer:

i believe that the answer is sedimentation

8 0
3 years ago
Why are offspring of organisms that reproduce sexually not genetically identical to their parents
Nat2105 [25]

Answer:

The offspring of organisms that is reproduce through sexually are not genetically identical to their parents because the offspring contains genes from two parents.

Explanation:

Identical offspring is only formed when offspring is produced from one parent through asexual reproduction such as building, binary fission and fragmentation. In sexual reproduction, offspring is produced by the mating of two organisms i. e. male and female organism. That's why genes of offspring are different from their parents and offspring is not identical to parents.

5 0
3 years ago
Read 2 more answers
The brain's _____ nucleus regulates the body's circadian rhythms.
deff fn [24]
The brain's suprachiasmatic nucleus regulates the body's circadian rhythms. The suprachiasmatic nucleus is a minute region of the brain located in the hypothalamus above the optic chiasm, the circadian rhythm is the 24-hour cycle of organisms, related to sunlight and temperature.
4 0
3 years ago
Other questions:
  • What does nicotine do to the body
    15·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Structure A is _____. Structure of mitochondrial membrane. The intermembrane space is located above the membrane and contains th
    11·1 answer
  • Only ____ can cause alcohol to leave the body.
    5·1 answer
  • If you are at point A, how many feet did you have to walk to get to point B?
    13·2 answers
  • We find DNA on the ___, In every living cell that an organism owns
    6·2 answers
  • The following Punnett Square is a monohybrid cross. It takes the genotypes of the parents and predicts the genotypes of their of
    15·1 answer
  • A cactus can either have long needles (L) or short needles (). A cactus
    10·2 answers
  • Describe the founder effect.
    9·1 answer
  • What are bacteria that can produce their own food without using the sun's energy called?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!