1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KonstantinChe [14]
3 years ago
8

Which or the following proccesses requires the expenture of cellular engery?

Biology
1 answer:
Deffense [45]3 years ago
8 0

Answer:

It would be C.) endocytosis

You might be interested in
Lichens are a symbiotic relationship which does not include Algae<br><br> True<br><br> False
Alex_Xolod [135]

Answer:

False

Explanation:

Organisms of same or different species interact in an ecosystem. The interaction of two organisms in an ecosystem is called SYMBIOSIS. A symbiotic relationship must include two organisms whose actions either benefits or harms one another.

In this question, Lichen is the term used for a symbiotic relationship between a fungi and an algae. It is called Symbiotic because two organisms are involved and those two organisms are Fungi and Alage. The symbiotic relationship between these two organisms is MUTUALISTIC in the sense that both organisms benefit from the relationship. The fungi absorbs water and nutrients from the soil while the algae supplies food via photosynthesis.

Hence, the answer is FALSE because LICHEN is a symbiotic relationship term that involves two organisms with ALGAE being one of those organisms.

6 0
3 years ago
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Can anyone help me ill give brainliest, ( I inserted a picture)
Setler [38]

Answer:

Magnitude and Direction.

5 0
2 years ago
Sea floor spreading happens in which plate boundaries?
Stolb23 [73]

Answer:

Divergent plate boundaries.

Explanation:

"As upwelling of magma continues, the plates continue to diverge, a process <u>known as seafloor spreading</u>. Samples collected from the ocean floor show that the age of oceanic crust increases with distance from the spreading centre".

Please mark as brainliest! Thank you <3

8 0
2 years ago
Bone marrow is the soft connective tissue of bone that includes red bone marrow and yellow bone marrow. Red bone marrow is _____
Sever21 [200]

Answer:

Bone marrow is the soft connective tissue of bone that includes red bone marrow and yellow bone marrow. Red bone marrow is <u>heteroglobic</u> (blood cell forming) and contains <u>redactive</u> connective tissue, immature blood cells, and fat.

In children, red bone marrow is located in the <u>cyclonic</u> bone of most of the bones in the body as well as the <u>antebellum</u> of long bones. Much of the red bone marrow degenerates and turns into yellow bone marrow as children mature into adults. As a result, adults have red bone marrow only in selected portions of the <u>irregular</u> skeleton. Some of these include the <u>dismantled</u> bones of the skull, the vertebrae, the ribs, the sternum, and the hip bones.

8 0
3 years ago
Other questions:
  • PLEASE I just need to know if it’s true or false!!!!! And it’s just<br> One question
    6·1 answer
  • In a desert, soil containing a mixture of sand and small rocks is exposed to wind erosion. Over time, how would the land surface
    8·2 answers
  • What is the term for a special layer that acts as a color filter for a single layer or for all the layers beneath it?
    15·1 answer
  • NEED HELP QUICK!!
    10·1 answer
  • What are the two functional parts of a charged tRNA?
    11·1 answer
  • what is the biological definition of a species? a.a group of organisms that look alike b.a group of similar organisms that live
    6·2 answers
  • 7 points
    12·2 answers
  • I am confused, could you please help. I’d appreciate it.
    14·1 answer
  • Which of the following is NOT a condition necessary for fossilization to occur?
    9·2 answers
  • Help me out please<br>A) Tropism<br>B) Night<br>C) Photoperiodism<br>D) Plant Hormones​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!