All categories

2 years ago

What are dominant and recessive allels

2 answers:

4 0

Dominant alleles are the genes the person or thing will more likely have
Recessive is the genes that are less likely to be passed on but still very much possible. I hope this helps you out :)

Contact [7]2 years ago

3 0

They are what gives a person his/her features
Dominant allels are going to be there for sure.
Recessive allels aren't going to be there for sure, but can come out and show.

You might be interested in

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

liubo4ka [24]

The mRNA generated below was produced in the nucleus of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

The synthesis of the mRNA s called transcription

The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.

It requires nucleotide triphosphates as substrates
catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0

2 years ago

A template is something that serves as ?

Harman [31]

Answer:

what kind of template

Explanation:

3 0

3 years ago

Will give Brainliest, need help!

motikmotik

I Think The answer is b I hope it helps

6 0

2 years ago

A deer has all white fur with the genotype (ff). This white deer mates with a grey deer (Ff). What is the chance that they will

Diano4ka-milaya [45]

It should be c. 50%, sorry if wrong >.

6 0

2 years ago

Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque

Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0

3 years ago