1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shusha [124]
3 years ago
8

Unlike white blood cells, red blood cells lose their ________ and ________ as they mature.

Biology
1 answer:
Mademuasel [1]3 years ago
7 0

Answer: Blank 1: Nucleus Blank 2: Organelles

You might be interested in
What is going if there is no atmospheric greenhouse
masha68 [24]

Answer:

Without naturally occurring greenhouse gases, Earth's average temperaturewould be near 0°F (or-18°C) instead of the much warmer 59°F (15°C). The concentration of greenhouse gases, especially carbon dioxide and methane, has fluctuated naturallyover geological time scales.

4 0
3 years ago
How does an area qualify as a biodiversity hotspot?
suter [353]

Answer: An area with lots of different kinds of plants and animals.

Explanation:

3 0
3 years ago
Read 2 more answers
Which describes the complex carbohydrate cellulose?
FromTheMoon [43]
Like starch, cellulose is a complex carbohydrate made up of many molecules of glucose linked together. But unlike starch, plants do not use cellulose to store energy. Instead, plants use cellulose as a structural molecule. It forms the cell wall that gives plant cells shape and support.
7 0
3 years ago
How does photosynthesis and cellular respiration move carbon, nitrogen, and water through the different Earth systems (biosphere
Mice21 [21]

Answer:

well the plants live and die from life to death they get there nutrients from water from rain. and oxygen from the air and nitrogen from the ground. the plant grows and dies. when it dies it decompose and puts nitrogen back into the soil along with the seeds that where produced in it's life time.

8 0
3 years ago
What is the function of white blood cells?
il63 [147K]
The white blood cells protect the body against both infectious disease and foreign invaders.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Explain the differences between adult and embryonic stem cells.
    14·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Based on Jill's observations, which conclusion could you draw?
    13·1 answer
  • The essential nutrients Multiple Choice
    5·1 answer
  • To adjust blood pressure independently in the capillaries of the gas-exchange surface and in the capillaries of the general body
    13·1 answer
  • What alcohol is found in triglyceride?
    9·1 answer
  • How do mutations cause variation?
    14·1 answer
  • The data below was collected in the field while studying the effect of pH on the growth of
    9·1 answer
  • What caused mass extinction in the past? what is causing mass extinction today?
    14·2 answers
  • Do you think human population growth is a concern in the United States?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!