1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gekata [30.6K]
3 years ago
5

How have some living things adapted to their eco system​

Biology
1 answer:
VARVARA [1.3K]3 years ago
6 0

Answer:

The key to the adaptation of living beings on the planet is the adaptation to abiotic factors such as temperature, light, salinity, humidity; and to biotic factors, which are represented by the action of the other organisms.

Explanation:

You might be interested in
Which describes gas exchange in the respiratory system?
kolbaska11 [484]

Answer:

A.

Explanation:

A. Gas exchange happens through diffusion.

6 0
3 years ago
Read 2 more answers
What is the difference between pure breeding and true breeding
romanna [79]
Purebreed is where both parents are the same breed to produce an offspring of the same breed.
6 0
4 years ago
Forests provide many different type your answer... for plants and animals.​
Papessa [141]

Answer:

Types of habitats

Explanation:

6 0
2 years ago
A(n) _______________ is made up of a glycerol backbone attached to three fatty acids.
romanna [79]
The answer to this question would be: triglyceride

Triglyceride is made of a glycerol with three fatty acids. A similar structure to this would be the diglyceride which was consist of glycerol with two fatty acids. Triglyceride could transport adipose fat or glucose to or from the liver. A high level of triglyceride is linked to heart disease and other atherosclerotic.
5 0
4 years ago
Read 2 more answers
Which group of Eukarya has complicated the phylogenetics of the domain by first being thought of as ancient as compared to the m
Dmitriy789 [7]

Answer:

arches bacteria hope this helps

6 0
3 years ago
Other questions:
  • Describe TWO WAYS technology has created more waste by humans.<br><br><br>I need an answer now.
    13·1 answer
  • Which concentration of alcohol is deemed most effective in alcohol-based hand cleaners?
    8·1 answer
  • Explain how the hitech provisions use health it to support health care reform.
    10·1 answer
  • You eat a hamburger and then go out and ride your bike. Trace the energy transformations involved going back to the source.
    9·1 answer
  • Refers to the Mediterranean world, centered around the Mediterranean and Black Sea
    6·1 answer
  • 1. Plants evolved from
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What's a good study strategy for an AP Biology exam?
    11·1 answer
  • Identify part A, B and C. What is the function of part B?
    15·1 answer
  • Which of the situations is an example of the crowding-out effect on investment as it pertains to macroeconomics?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!