1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vedmedyk [2.9K]
3 years ago
7

Why are index fossils useful to geologist

Biology
2 answers:
SpyIntel [72]3 years ago
6 0

Answer:

Explanation:

Index fossils (also known as guide fossils or indicator fossils) are fossils used to define and identify geologic periods (or faunal stages). Index fossils must have a short vertical range, wide geographic distribution and rapid evolutionary trends.

Index fossil, any animal or plant preserved in the rock record of the Earth that is characteristic of a particular span of geologic time or environment. A useful index fossil must be distinctive or easily recognizable, abundant, and have a wide geographic distribution and a short range through time. Index fossils are the basis for defining boundaries in the geologic time scale and for the correlation of strata. In marine strata, index fossils that are commonly used include the single-celled Protista with hard body parts and larger forms such as ammonoids. In terrestrial sediments of the Cenozoic Era, which began about 65.5 million years ago, mammals are widely used to date deposits. All of these animal forms have hard body parts, such as shells, bones, and teeth, and evolved rapidly.

IgorLugansk [536]3 years ago
3 0

Answer:

pp

Expladmnc xcx xxcnation:

You might be interested in
Explain how the adaptation to reproduce quickly is beneficial in bacteria's ability to
JulijaS [17]

Answer:

Antibiotics save lives but any time antibiotics are used, they can cause side effects and lead to antibiotic resistance.

Since the 1940s, antibiotics have greatly reduced illness and death from infectious diseases. However, as we use the drugs, germs develop defense strategies against them. This makes the drugs less effective.

6 0
3 years ago
What is an advantage of recycling metals?
brilliants [131]
D) Lesser amounts of fresh metals would be needed.
8 0
3 years ago
Read 2 more answers
The central nervous system consists of the brain and the ________.
Anton [14]

Answer:The answer is spinal cord

Explanation:

The central nervous system consists of the brain and the spinal cord.

The brain is the most highly specialized organ, and is protected by the skull or cranium, while the spinal cord is made up of soft tissue which runs from the medulla oblongata to the tail region. It is protected by the bones of the vertebral column.

The spinal cord acts as a PATHWAY between spinal nerves and the brain.

7 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
relay runner is running 1 m/s and reaches 5m/s when given the baton after 3 sec. What is the acceleration? (Make sure you do the
Len [333]

Answer:

4/3 m.s2 forward

Explanation:

final velocity minus initial velocity. divide all of that by 3 seconds

4 0
3 years ago
Other questions:
  • Which factor can affect the rate of photosynthesis by denaturing enzymes in the plant?
    10·2 answers
  • Gas exchange takes place in the
    5·2 answers
  • Which sample has the most evenness among the species studied?
    13·2 answers
  • Pairs of the same chromosome as found in a karyotype are called homologous chromosomes. True False
    11·1 answer
  • AAC –GCC – GTC –CGC – TAG
    6·1 answer
  • What happens when an antigen is introduced into an organism?
    14·1 answer
  • How are our red blood cells similar to a bus or taxi?
    12·2 answers
  • Plz don't report. related to studies (bio). don't scam
    13·1 answer
  • URGENT PLZ ANSWER!!!!!!!!!!!!!
    12·2 answers
  • 3. Species that are in danger of becoming extinct in the near future is known a. endangered species c. Exotic Species Species c.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!