1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
3 years ago
14

Describe the three main steps of each cycle of PCR amplification and what reactions occur at each temperature.

Biology
1 answer:
marta [7]3 years ago
4 0

Answer:

The three main steps of PCR amplification are :

Denaturation

Annealing

Elongation

Explanation:

Polymerase Chain Reaction (PCR) can best be describes as a procedure to amplify or make copies of DNA fragments.

The basic steps involved for PCR are :

1. Denaturation

In this step, the two complementary strands of DNA are seperated by the usage of heat. The best temperature for this procedure is 95°C.

2. Annealing

After denaturation, each strand of DNA serves as a template foe building a new strand.  During the process of annealing, the temperature is reduced so that the primers can attach to the DNA strands. The optimum for this depends on the nature of the primers but usually the most feasible temperature is 55°C.

3. Elongation

In this step, the DNA polymerase adds nucleotides to the primers attached to the templates. The optimum temperature For DNA polymerase to work is 72°C.

You might be interested in
5. Galileo used a(n) that had a lens to bend light.
Kruka [31]

Answer:

v,n v.mnkhj fkhlkfmnj lkmn weol,fgkmj j hwejfq3

Explanation:

kjbdonlfjkh gbfvwef,lknojb gflwj nf

5 0
2 years ago
Read 2 more answers
-3X+3(2X-6)=6 answer
Dahasolnce [82]
-3x + 3(2x - 6) = 6

-3x +6x - 18 = 6

3x - 18 = 6

3x = 6 + 18

3x = 24

x = 8

hope this helped, blessing! :)
5 0
3 years ago
Read 2 more answers
Identify two oral conditions related to nutritional factors
Lina20 [59]
Ill look for it hold on
8 0
3 years ago
What were the ultimate consequences of wealth inequalities during the 18th century?
amm1812

Answer:

It led to a wide range of protests by the people which brought about revolution

Explanation:

The ultimate consequences of wealth inequalities during the 18th century was wide range of protests by the people which brought about revolution.

This was because of the high poverty rate and difference between the classes in the society as the rich got richer due to policies which favored them while the poor got poorer due to the bad policies which made them register their displeasure and move for a revolution.

3 0
3 years ago
How does water's specific heat relate to its usefulness for life give examples?
RideAnS [48]
<span>Water covers around 70% of the Earth's surface and its high specific heat plays a very important role as it is able to absorb a lot of heat without a significant rise in the temperature. When temperatures decrease, the heat which is stored is released, restraining a rapid drop in temperature. The combined effect of these processes is a buffering of temperature on the Earth.</span>
6 0
2 years ago
Other questions:
  • A vertebrate has scaly skin, internal fertilization, and amnionic eggs. Which class does this vertebrate belong to?
    10·2 answers
  • Which of these processes does not occur in animal cells?
    6·2 answers
  • In an animal cell , how is the DNA from the organelle inherited ?
    14·2 answers
  • Is it normal or abnormal to have respiratory depression after a bronchoscopy hurst review?
    6·1 answer
  • The highly organized system of neurones which generate and convey signals in the form of electronic impulses.
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • At what stage of development is the embryo a hollow ball of identical cells?
    8·1 answer
  • The smooth ER also plays a large role in( blank), which breaks down toxic materials in the body
    14·1 answer
  • In what way are the planets mars mercury and earth similar ?
    7·1 answer
  • PLEASE HELP!!!!!!!!!
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!