1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mart [117]
3 years ago
14

What calculation can be used to find the value of y in the equation y^3=27

Mathematics
2 answers:
sleet_krkn [62]3 years ago
4 0

Answer:

Cube root both sides

Step-by-step explanation:

y^3=27\\Cube-root-Both-sides-of-the-equation\\\sqrt[3]{y^3} = \sqrt[3]{27} \\y = 3

Romashka-Z-Leto [24]3 years ago
4 0

Answer:

y=3

Step-by-step explanation:

.

You might be interested in
The local genealogical society in Coles County, Illinois, has compiled records on all 55,914 gravestones in cemeteries in the co
krok68 [10]

Answer:

Step-by-step explanation:

There are 2 ways to proceed further.

Option A is with using the random number table.

  1. Let us assume that each gravestone has  a unique number between 1 and 55914.
  2. Choose a row at random from  the table.
  3. Take the first number consisting of 5 digits, if the number corresponds with a number between 1 and 55914, then select the corresponding plot, otherwise move on to the next 5 digit-number.

Repeat until 395 gravestones have been selected.

Option B is with using any calculator with capability of generating random integer. Here  for example consider any TI series programmable calculator.

  • Enter the following command into your calculator:

                                   randInt(1,55914,395)

  • The first and second number are the lower and upper limits between which the values have to lie.
  • The third number is the number of required selections.
3 0
3 years ago
Y=2/3x-1 in standard form
Artyom0805 [142]
In standard form it would be 2x - 3y = 3
5 0
3 years ago
Sarah and Gabriela are at a soccer camp. The length of a soccer practice is 2/3 hour. The coaches have set aside 8 hours for soc
Nesterboy [21]

Answer:

12 soccer practices

Step-by-step explanation:

1 Soccer practice = 2 / 3 hour

We have 8 hours

8 / 2/3

multiply the top and bottom by 3 to get rid of the 3

8 * 3 = 24

2/3 * 3 = 2

24 / 2 = 12

4 0
3 years ago
Read 2 more answers
Hii I really need help!!
borishaifa [10]

Answer:

1.645 ft

Step-by-step explanation:

Divide the length of the board by the number of pieces it will be cut into

8.225/5=1.645 ft

4 0
2 years ago
Please help me!!!!!””
Advocard [28]

Answer:

d=45t

Step-by-step explanation:

to find speed you divide the distance by the time. 67.5/1 1/2 = 45

3 0
3 years ago
Read 2 more answers
Other questions:
  • 1. What is the value of x? Enter your answer in the box
    9·2 answers
  • Let g(x)=x-3 and h(x)=x^2+6 find (h o g) (1)
    5·2 answers
  • Based on experimental data, the function T(x) = -3(x − 4)3 + 10 models the temperature of a special substance after being placed
    6·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Find the missing angels (Quickly)
    14·2 answers
  • Drag the tiles to the boxes to form correct pairs. Find the probability for the given situations, and then match the situations
    7·1 answer
  • singh works at a restaurant where he is paid by the hour plus time and a half for his hours over 40. last week he worked four ho
    13·1 answer
  • Required information Skip to question A die (six faces) has the number 1 painted on two of its faces, the number 2 painted on th
    6·1 answer
  • Plss help... Dalvin's family took a road trip to Mount Rushmore. Dalvin fell asleep 44% of the way through the trip. If Dalvin f
    14·2 answers
  • Is 2.25 plus 6 irrational
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!