1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Angelina_Jolie [31]
3 years ago
15

Which of these are a behavioral adaption in wolves

Biology
2 answers:
ivanzaharov [21]3 years ago
6 0

B: Hunting in packs

The other answers are physical traits.


Alecsey [184]3 years ago
3 0

The answer your looking for is B) Hunting in packs.

Sorry I'm late, hope it helps :)

-Mo x

You might be interested in
Design a plan that can be used by oil workers everywhere to save ecosystems
faust18 [17]

Answer:

Oil workers activities involved in the exploration of crude oil and natural gas creates pollution which affects the ecosystem negatively. The various pollutions cause the death of plant and animal life both on land and in water bodies.

The oil workers should be more careful in their activities to prevent oil spillage as much as possible and if there is any at all then there should be adequate measures in the cleaning it up efficiently through biological and harmless chemicals.

3 0
3 years ago
Cancer is a disease in which cells?
Lorico [155]

A grow and divide uncontrollably.

3 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
What is evolution?
strojnjashka [21]

Answer:

O the process in which inherited traits of a population change over many generations

Explanation:

The traits of a populations evolve or "change" over many generations

8 0
3 years ago
Read 2 more answers
Transpiration theory is.....
Alja [10]

Answer:

C.

Explanation:

water is continuously evaporating from the surface of leaf cells exposed to air to cool the plant and access nutrients in the soil more efficiently.

5 0
3 years ago
Other questions:
  • What is the dietary iron of food sources not associated with hemoglobin called?
    9·1 answer
  • Biodiversity is one key to the long term sustainability of life on Earth.<br>A. True<br>B. False​
    11·2 answers
  • Why is it important not to apply ice packs directly to the skin?
    5·1 answer
  • What is the genotype of the offspring missing on the first row of the punnett square?
    5·2 answers
  • Darwin was offered a position on the _________________ whose mission was to survey the waters around South America.
    6·1 answer
  • In 3–5 sentences, explain the various factors that should be considered when implementing green roofs.
    13·1 answer
  • When comparing cells to organs, which best describes how organelles differ from organs?
    6·2 answers
  • What would happen to a deep sea fish brought rapidly to the surface? Explain your answer in light of the fact that gas pressure
    7·1 answer
  • FUN FACT:<br> the Swine flu was a strand of Coronavirus
    6·1 answer
  • What causes sunburn? Why do we have trouble perceiving the energy that causes it?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!