1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pentagon [3]
3 years ago
11

Gonist is to antagonist as _______________ is to _______________.

Biology
1 answer:
max2010maxim [7]3 years ago
4 0
D. neurotransmitter blocking; neurotransmitter enhancement
You might be interested in
During which days of the menstrual cycle does the level of FSH increase?
Sophie [7]

Explanation:

During the first week after menses (in a 28 days cycle), FSH continues to increase, the follicles grow intensely and FSH increases the expression of its own receptor and of the LH receptor on the granulosa cells.

6 0
2 years ago
Help me please anything will help I also think its D
kari74 [83]
C is the right answer
7 0
2 years ago
What are the major families of macroinvertebrates?
Elden [556K]

Answer:

lipids proteins and nucleic acids

7 0
3 years ago
I need a small text (about 50 words) for the human brain.
Artemon [7]

Answer:

The human brain is the command center for the human nervous system. It receives signals from the body's sensory organs and outputs information to the muscles. The human brain has the same basic structure as other mammal brains but is larger in relation to body size than any other brains.The largest part of the human brain is the cerebrum, which is divided into two hemispheres, according to the Mayfield Clinic. Underneath lies the brainstem, and behind that sits the cerebellum. The outermost layer of the cerebrum is the cerebral cortex, which consists of four lobes: the frontal, parietal, temporal and occipital. [Nervous System: Facts, Functions & Diseases]

Like all vertebrate brains, the human brain develops from three sections known as the forebrain, midbrain and hindbrain. Each of these contains fluid-filled cavities called ventricles. The forebrain develops into the cerebrum and underlying structures; the midbrain becomes part of the brainstem; and the hindbrain gives rise to regions of the brainstem and the cerebellum.

Explanation:

4 0
3 years ago
Which BEST describes why the hatchet fish has been able to survive?
poizon [28]

Answer:

It has adapted to feed on available food

Explanation:

4 0
3 years ago
Other questions:
  • Which of the following insulate against the cold? carbohydrates lipids nucleic acids proteins
    6·2 answers
  • Name the three major internal parts of the plant stem and identify their functions
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Pls help ASAP oekeidneiansje
    9·1 answer
  • With a suitable diagram explain reflex action and reflex arc
    5·1 answer
  • A patient has an open displaced fracture of the second cervical vertebra. this is her fifth visit and the fracture is healing no
    8·1 answer
  • The mutation resulting in sickle cell disease changes one base pair of dna so that a codon now codes for a different amino acid,
    8·1 answer
  • What are the benefits of sexual reproduction for plant and animal species?
    6·1 answer
  • Join among us code for my insta NBJPZF
    15·1 answer
  • Why does the invasive brown treesnake have a negative effect on the biodiversity of guam?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!