1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lara [203]
3 years ago
9

The two energy containing compounds created in the light-dependent reactions that are used in the light-independent reactions ar

e ________ and _________.
A.) ADP and NADP
B.) NADPH and ATP
C.) Water and Glucose
D.) Pyretic acid and ATP synthase
Biology
1 answer:
Anni [7]3 years ago
7 0

Answer: The correct answer for the fill in the blank is B) NADPH and ATP.

Light dependent phase is the first phase of photosynthesis. In this phase, chlorophyll pigment absorbs energy from sunlight ( in the presence of CO₂ and H₂O ) through a series of chemical reactions and form ATP and NADPH, which are the energy containing compounds.

This energy is then utilized in the formation of food ( glucose) in the next stage, which is light independent phase of photosynthesis.

Thus, option B) is the right answer.

You might be interested in
One possible explanation for infant amnesia related to encoding specificity is that we repress the cues needed to retrieve infan
Zielflug [23.3K]
One possible explanation for infant amnesia related to encoding specificity is that adults lack the retrieval cues for infant memories because of body changes. The Infant amnesia denotes to the incapability that adults have in memorizing comprehensive memories in which memories were the time, the place and the events can be recognized from early childhood former to age 3 or 4. 
3 0
3 years ago
What is the envelope of gas that surrounds Earth?
Sonja [21]

Answer:

a-atmosphere

Explanation:

atmosphere is a body of gases located on a planet or other materials

5 0
3 years ago
Which are classified as sac fungi?
Vinvika [58]
The answer is: A - truffles, morels, yeast
4 0
2 years ago
Explain why the resistance of the current path through the extracellular fluid is much smaller than the resistance of the curren
vodka [1.7K]

Answer:

The correct answer is - the large cross-sectional area and greater length of the cytoplasmic core get less resistance than the smaller cross-sectional area.

Explanation:

The greater length and the large cross-sectional area of the cytoplasmic path or core get less resistance than the resistance of the current path which is the small cross-sectional area of axoplasm. This leads it to greater resistance than the resistance of the current path through the extracellular fluid.

Other than this there is also an unequal distribution of the ions that leads to the increase in potential difference as higher Na+ ions present in cytoplasm and high amount of K+ ion present in axoplasm.

4 0
3 years ago
How do animals and other organism access glucose for cellular respiration?
fomenos

▪▪▪▪▪▪▪▪▪▪▪▪▪  {\huge\mathfrak{Answer}}▪▪▪▪▪▪▪▪▪▪▪▪▪▪

Correct choice is " Eating Carbohydrates "

Animals and other organisms access Glucose for cellular respiration, by eating <u>Carbohydrates</u> .

5 0
2 years ago
Other questions:
  • Two or more units are added together to form a new compound<br> ons are defined as _____.
    7·2 answers
  • Termos e fatores ecossistema e comunidade são sinônimo
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The total magnification of a specimen viewed under a compound light microscope is determined by
    9·1 answer
  • The ability of an organism to maintain internal stability is known as?
    5·1 answer
  • _____, the large maggots move away from the body, sometimes into the soil.
    14·1 answer
  • Hi! I need help with a Mountains Beyond Mountains assignment, has any one read it?
    12·1 answer
  • How do changes to genes affect the traits of an organism
    7·2 answers
  • 1. Which of the following describes interphase? (1 Point)
    8·1 answer
  • Mrs james has noticed that some of her learners show signs of poverty a child that is hungry finds it difficult to concentrate a
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!