1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRa [10]
2 years ago
15

Complete the Punnett square below by showing the genetic makeup of the parent plats of the cross shown.Be sure to show both gene

s for each parent.

Biology
1 answer:
aksik [14]2 years ago
8 0

Answer:

The correct answer is -

Parent 1: RW, Parent 2: RR

Explanation:

In the given punnet square there are four offspring and it is a monohybrid cross between parent 1 and parent 2. The four offspring produced in this cross have RR, RR, RW, and RW alleles. By the genotype of the offsprings, it is clear that there are 50 percent pure or true-bred and 50 percent are heterozygous.

Each parent contribute two alleles and these alleles are independently assort in the zygote to form offspring so there must be R, R, R and W allele present in the parent

Parent 2  →       R     R

Parent 1 ↓     R  RR   RR  (one allele (R) come from each parent in zygote)

                    W  RW  RW (one allele  (R and W) come from each parent)

You might be interested in
Where do you think this bird would most likely live? Explain how two of the bird’s features would help it to survive in its envi
gavmur [86]

Answer:

water because it has webbed feet

Explanation:

6 0
2 years ago
The human population began to increase noticeably around 10,000 years ago. what has been hypothesized as the reason for the popu
arsen [322]
It is observed that the human population keep increasing significantly and it began to increase noticeably around 10,000 years ago.The greatest factor of this increase is the rapid development of the agricultures in lands, as well as the domestication of animals. These are the reasons why population increases at that time.
8 0
3 years ago
When conducting scientific research or experimentation, researchers carefully analyze and evaluate results to determine a valid
Igoryamba
The answer is actually D. I just took a test 
8 0
3 years ago
Read 2 more answers
Compare and contrast the elements in Group 1 and the elements in Group 17
IgorLugansk [536]
<span>7 electrons in each outer shell
Group 17
Most reactive
Fluorine, Chlorine, Bromine, Iodine, Astatine
Alkali Metals:
1 electron is each outer shell
Group 1
Also reactive, but not as much as the halogens
Lithium, Sodium, Potassium, Rubidium, Cesium, Francium </span>
5 0
3 years ago
What class of organic compounds is composed of amino acids?
Mashutka [201]
Amino acid<span>, </span>any of a group of organic molecules that consist of a basic amino group (−NH2<span>), an acidic carboxyl group (−COOH), and an organic </span>R<span> group (or side chain) that is unique to each amino acid. </span>
7 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which shows the correct order of processes the body undergoes to maintain blood glucose levels?
    13·1 answer
  • What does it mean for an atoms behavior if it is missing electrons in the valence shell?
    12·1 answer
  • How to convert 2499 nucleotides to the number of amino acids?
    15·1 answer
  • Which statements accurately describe anaerobic cellular respiration? Check all that apply. Oxygen is present during this process
    7·2 answers
  • A series of food chains connected together is called a
    12·1 answer
  • Can you identify characteristics of type 1 and type 2 diabetes?To learn about diabetes, watch this BioFlix animation: Homeostasi
    10·1 answer
  • 3. Which of the following do all living things need to survive? a. water b. oxygen c. sunlight d. carbon dioxide
    6·2 answers
  • 3.- Cuáles son los parámetros para la valoración de los efectos producidos por los impactos ambientales
    12·1 answer
  • Cells quiz need help
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!