1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bogdan [553]
4 years ago
8

Which is an example of how ecosystems on Earth affect each other?

Biology
1 answer:
Rina8888 [55]4 years ago
6 0
The answer should be b
You might be interested in
Why must all organisms carry out metabolism
S_A_V [24]

to digest food in order to get nutrients.

3 0
4 years ago
Define organelle and describe why organelles are important to the cell.
Gnesinka [82]
An organelle is a cellular structure which performs specific functions within a cell. Organelles are important to the cell as cells would not be able to function without them: even the most common organelle - the nucleus. A cell without a nucleus cannot function (except prokaryotes, as they have an undefined nucleus)
4 0
4 years ago
Kidneys are part of the excretory system in a human body. They purify the impure blood and send it back to the rest of the body.
notsponge [240]

Answer:

The Circulatory System

3 0
3 years ago
Genes for traits that help organism be more successful reproductively can be expected to
liraira [26]
Pass on through generations
8 0
3 years ago
A decreased ph coupled with a decreased plasma concentration of bicarbonate ion indicates that __________ is occurring and the _
stira [4]
A decreased pH coupled with a decreased plasma concentration of bicarbonate ion indicates that acidosis is occurring and the respiratory system will compensate for this change.  
<span>Acidosis (metabolic) is a state when increased acidity in the blood occurs and it usually refers when arterial pH falls below 7.35. Metabolic acidosis may result from increased production of metabolic acids (lactic, for example) and is characterized by low pH, low blood HCO3, and normal or low PaCO2. Metabolic acidosis is compensated with an increased exhalation of CO2 to reduce metabolic acid.</span>
6 0
4 years ago
Other questions:
  • Name one location where you might see fractals in everyday life brainly
    10·2 answers
  • Check my work mcallister transport ships hazardous waste over thousands of miles, but fails to properly label and package the wa
    12·1 answer
  • Only some plant cells have chloroplasts, but all actively metabolizing plant cells have mitochondria. why?
    10·1 answer
  • Which of the following adaptations does not protect tundra organisms from heat loss?
    15·2 answers
  • Photosynthesis consists of which two primary steps
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • What happens to the energy that the herring take in when they consume their prey
    7·2 answers
  • Which of the following pairs of organisms is most closely related?
    14·1 answer
  • 9. What is a larger threat to the people who live in Hawaii, lava flows or a tsunami? Explain
    6·1 answer
  • Cell Division lab
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!