1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harkovskaia [24]
3 years ago
8

DNA and histones form bread-like globules known as​

Biology
1 answer:
Lunna [17]3 years ago
5 0
DNA and Histones Form bread-like globules known as nucleotides
You might be interested in
7. Which of the following is a physical change in matter that takes
klasskru [66]

Answer:Mechanical digestion physically breaks down food, like when teeth macerate food into a bolus. The stomach contracts and relaxes in a churning motion. ... Chemical digestion occurs when the bonds within larger food molecules are broken, creating smaller molecules that the body can use.May 30, 2017

Explanation:

7 0
3 years ago
WILL GIVE A BRAINLEST
Oksana_A [137]
The answer is density-dependent factor
4 0
2 years ago
Read 2 more answers
Believe it or not, the tundra is like the desert in one very important way. The similarity results in plants with a like adaptat
kirza4 [7]

Answer:

Low rainfall and available water; waxy coating on leaves to prevent drying.

Explanation:

6 0
3 years ago
Which diagram or diagrams represent a mixture
777dan777 [17]
To substances that are bonded together but can be taken apart
8 0
3 years ago
Name on ion that have entered the plant by diffusion. Explain your answer
Anna11 [10]

Answer:

Water, carbon dioxide, and oxygen are among the few simple molecules that can cross the cell membrane by diffusion (or a type of diffusion known as osmosis ). Diffusion is one principle method of movement of substances within cells, as well as the method for essential small molecules to cross the cell membrane.

6 0
2 years ago
Other questions:
  • A nurse on a psychiatric unit is planning care for an unconscious teenage client who ingested a non-corrosive substance that has
    10·1 answer
  • Which of the following is NOT part of the theory of natural selection? Question options:
    11·1 answer
  • The independent variable in an experiment is
    9·1 answer
  • _____ modify the rate of enzyme activity.
    9·2 answers
  • What change is observed in leukocytes during an allergic disorder (type I hypersensitivity) often caused by asthma, hay fever, a
    13·1 answer
  • -. What are the 6 phases of The Cell Cycle?
    15·1 answer
  • Most flowering plants can achieve pollination in several different ways. Those that produce pollen and carpels on the same plant
    11·1 answer
  • Plants have many different hormones that influence their growth, development, and life cycle. For example, a cluster of over-rip
    6·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How does the codon help determine the function of the protein it is coding for?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!