1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gwar [14]
4 years ago
8

Some scientists theorize that continental movements may cause climate changes by _____.

Biology
2 answers:
antoniya [11.8K]4 years ago
8 0

Answer:pollution i believe is the answer

Explanation:

PolarNik [594]4 years ago
5 0

Answer: Changing Patterns Of Ocean Currents Is The Correct Answer.

You might be interested in
Which of the following would best characterize an ecosystem? *
enot [183]

Answer:

It would be the last one: All organisms as well as the climate, soil. water, rocks, and other nonliving things

Explanation:

The first one is an organism

The second one is a population

And the last statement is a ecosystem

Hope this helped

7 0
4 years ago
Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
leva [86]
The answer is (B. Genes hope it helped
3 0
3 years ago
Read 2 more answers
What does this image show about the enslaved person’s transatlantic experience?
wolverine [178]
It shows that the trip was cramped and horrific and the people who were transporting them surely didn't consider them in anyway human. propane 
4 0
3 years ago
Read 2 more answers
The most commonly contracted type of skin cancer is: a. basal cell carcinoma b. squamous cell carcinoma c. melanoma d. none of t
umka21 [38]
A , basal cell carcinoma is the most commonly contacted type of skin cancer
8 0
3 years ago
Read 2 more answers
How did the composite volcano in the image get its layered interior?
Snezhnost [94]
<span>By using seismic waves .</span>
4 0
3 years ago
Other questions:
  • Which process can be used to power your home?
    10·2 answers
  • Similarities and differences between prokaryotic cells and eukaryotic cells
    9·2 answers
  • PLEASE HELP ME WITH THIS! Tsunamis can be caused by..
    5·1 answer
  • ose the item in column 2 that best matches each item in column 1. axonemal microtubules nucleation treadmilling desmin EB1 Arp2/
    15·1 answer
  • What proportion of the body’s weight does the skeletal system make up ?
    12·2 answers
  • Hi! can someone help with this question?
    12·1 answer
  • How was Hawaii formed, and how does this provide evidence for convection happening?<br> HELP PLEASE
    15·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • What is the process that changes one set of chemicals into another set of chemicals?
    7·2 answers
  • 18. How are villi, alveoli and nephrons similar?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!