Answer:
A <u><em>receptor</em></u> is a protein that recognizes and responds to a signal.
Explanation:
A receptor is a protein molecule present on the cells on which the signalling molecules can bind and generate a physiological response. Some receptor molecules can also respond to Sun and light. Each type of cell has specific receptors molecules and hence can respond to specific signals. The receptor molecules hence tend to receive signals for a cell. Molecules such as hormones bind to the receptors.
The answer is C plants do photosynthesis to make their own food however animals do not
The statement that describes this prediction is as follows:
- The prediction is useful because it explains what observations will be made if a hypothesis is true.
Thus, the correct option is D.
<h3>What is Herbicide?</h3>
Herbicide may be defined as a chemical agent that is responsible for destroying or inhibiting the growth of a particular plant as compared to the normal one.
The projection is necessary because it supports the product after a one-year duration. So for example, if after one year there is undoubtedly a reduction in the intermediate height of the tomato plants, then we can absolutely say that it is because of the existence of NoGro herbicide which is supplied in water.
Therefore, it is well described above.
To learn more about Herbicides, refer to the link:
brainly.com/question/21807353
#SPJ1
Answer:
A. The schnauzer has more fur than the grey wolf.
Explanation:
hope this helps
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: