1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leona [35]
3 years ago
10

Name two other plants that have runners.

Biology
1 answer:
lord [1]3 years ago
7 0
Stolons also know as runners , are horizontal connection between organisms . Potatoes and grass Just my best
You might be interested in
What part of the body system is that
Keith_Richards [23]
This is the excretory system
8 0
3 years ago
Read 2 more answers
Comparative morphology ______.
Ivanshal [37]

Answer: analysis the similarities and differences between organisms of the same species

Explanation:

Comparative morphology is analysis of the patterns of the locus of structures within the body plan of an organism, and forms the basis of taxonomical categorization. Functional morphology is the study of the relationship between the structure and function of morphological features.

4 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Which of the chains of amino acids corresponds to the nucleotide sequence CCUGAUUCC?
777dan777 [17]
I think the correct answer from the choices listed above is option D. The chain of amino acid that corresponds to the nucleotide sequence CCUGAUUCC would be  Leucine–valine–phenylalanine. Hope this answers the question. Have a nice day.
3 0
3 years ago
When caring for a patient with laennec's cirrhosis, which of these does the nurse expect to find on assessment?
aksik [14]
The nurse expects to find a prolonged partial thromboplastin time Icterus of skin swollen abdomen. Laennec's cirrhosis is a disease of the liver in which the normal lobular architecture is lost, with fibrosis and later nodular regeneration. It can be associated with inflammatory polyarthritis, most commonly affecting the shoulders, elbows and knees. 
6 0
3 years ago
Other questions:
  • I put all the points i had in this s please help
    12·1 answer
  • Which idea did Lamarck propose that was rejected by his fellow scientists?
    8·1 answer
  • Summarize the bonding properties of carbon
    13·1 answer
  • What is the meadure of the amount of matter in agiven amount of space​
    9·1 answer
  • What is the purpose of B cells?
    8·2 answers
  • Cellular respiration is the process in which glucose is broken down into carbon dioxide and water, releasing cellular energy in
    11·2 answers
  • What is genetic engineering and important of genetic engineering​
    13·1 answer
  • There’s less water available for human consumption. Which biome is affected the most by this change?
    8·1 answer
  • Hey can u help me?<br><br><br><br><br>what is photosynthesis?​
    10·2 answers
  • Carbon is rare in that it does NOT bond with any other elements.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!