This is the excretory system
Answer: analysis the similarities and differences between organisms of the same species
Explanation:
Comparative morphology is analysis of the patterns of the locus of structures within the body plan of an organism, and forms the basis of taxonomical categorization. Functional morphology is the study of the relationship between the structure and function of morphological features.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
I think the correct answer from the choices listed above is option D. The chain of amino acid that corresponds to the nucleotide sequence CCUGAUUCC would be Leucine–valine–phenylalanine. Hope this answers the question. Have a nice day.
The nurse expects to find a prolonged partial thromboplastin time Icterus of skin swollen abdomen. Laennec's cirrhosis is a disease of the liver in which the normal lobular architecture is lost, with fibrosis and later nodular regeneration. It can be associated with inflammatory polyarthritis, most commonly affecting the shoulders, elbows and knees.
