1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRissso [65]
3 years ago
5

Arrange the following structures in the order in which they vibrate when a sound wave enters the ear. eardrum (1) endolymph (2)

ossicles (3) oval window (4) perilymph (5)
Biology
1 answer:
monitta3 years ago
5 0

Answer:

Eardrum→Ossicles→Oval window→Endolymph→Perilymph

Explanation:

The Ear is the organ of hearing and in mammals balance. In mammals the ear is often described as having three parts- The outer ear, the middle ear and the inner ear. the outer ear consist of the pinna and ear canal. The middle ear include the lymphatic cavity and the three ossicles. The inner ear sits in the bony labyrinth, and contain structures which are key to several senses: The semi circular canal which enable balance and eye tracking when moving. The Utricle and saccule which enable balance when stationary and the cochlea which enable hearing.

You might be interested in
Which statement best describes selective breeding?
Akimi4 [234]

Answer:

D. People allow only organisms with certain traits to reproduce.

7 0
3 years ago
Read 2 more answers
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
How does an increase in available food increase genetic diversity?
Dafna1 [17]

Answer:

more food means more of the species would stay alive longer so that would mean obviously more mating and mutations.

Explanation:

4 0
3 years ago
Read 2 more answers
To differentiate as a specific type of cell (example as a muscle cell versus a skin cell),
Lorico [155]

Answer: false

Explanation:

Different parts of DNA are switched on or off to activate genes required for the cell specific function. Under certain conditions cells can de-differentiate, or express different genes e.g. cancer cells.

6 0
3 years ago
I need help writing about epigenetic.
Sati [7]
Epigenetic is the study in the field of genetics of cellular and physiological phenotypic trait variations that are caused by external or environmental factors that switch genes on and of and affects how cells read genes instead of being caused by changes in the DNA sequence. Therefore, hence epigenetic research seeks to describe dynamic alterations in the transcriptional potential of a cell.

Hope this helps you!
8 0
4 years ago
Other questions:
  • What kind of cell has a large, central, vacuole
    13·2 answers
  • Bacteria reproduce asexually. Identify the answer choice below that is the mostly likely way a bacterium would reproduce.
    6·1 answer
  • Which two structures would provide a positive identification of a plant cell under a microscope?
    10·2 answers
  • How does the body respond to changes in its environment
    8·2 answers
  • If a mother has type AB blood and the father has type O blood, can the son be type O?​
    15·2 answers
  • Keeping medical information about a patient out of the view of visitors is an example of what?
    12·1 answer
  • Thinking about Mendel’s earlier studies, does the gene that determines the shape of a seed have anything to do with the seed col
    9·1 answer
  • A chemist reacts 128.95 g of Fe3N2 and 32.34 g of Al as shown below.
    14·1 answer
  • What is the important of ecological factors to organisms<br>​
    12·1 answer
  • How much force do you need to need to push a naughty elephant that squirts water that is 300 kg to accelerate 10 m/s 2 ?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!