1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
My name is Ann [436]
3 years ago
15

I have 5 questions i need help on please help

Biology
1 answer:
Hoochie [10]3 years ago
7 0

1. Is 23 because we all have 46 so half is 23

You might be interested in
Start with the temperature at 25 ºC and the pH at 7. Do not vary these parameters while testing for substrate (Initial Lactose)
UNO [17]

Answer:

The results show that the increase in the substrate concentration is increasing the rate of the reaction. We can see that the reaction rate has increased to 2.88mM/min. After this even if we increase the substrate concentration

5 0
2 years ago
In which part of the circulatory system does the exchange of oxygen and dioxide take place between blood and cells?
bija089 [108]

The exchange takes place in the millions of alveoli in the lungs and the capillaries that envelop them. As shown below, inhaled oxygen moves from the alveoli to the blood in the capillaries, and carbon dioxide moves from the blood in the capillaries to the air in the alveoli.

6 0
3 years ago
Select the structures and functions of the large intestine from the choices below
grin007 [14]

Answer:

Structure of large intestine: Large intestine is the part of digestive system which comes in the end. It consist of four parts. Large intestine length is 150 cm and width is 5 cm.

Function of large intestine: It performs two main functions.

1) Large intestine helps in the absorption of water and nutrients from the food which cannot be digested in the stomach.

2) It removes the waste material from the body in the form of feces.

6 0
3 years ago
Meiosis is of evolutionary signicance as it
Ludmilka [50]

Answer:

d

Explanation:

four daughter cells are produced in meiosis

3 0
3 years ago
Describe the characteristics of a vertebrate. Include an example.
Marta_Voda [28]

Answer:

They have a backbone, most use legs,wings,or fins for movement.

5 0
2 years ago
Read 2 more answers
Other questions:
  • Which phrase describes the role of the mitochondria?
    7·1 answer
  • An important characteristic of antibacterial drugs is their selective toxicity. if antibacterial drugs were not selectively toxi
    7·1 answer
  • I need answers to #2
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Explain how xylem cells are adapted for their function.<br>​
    15·2 answers
  • In animals how do oxygen and food travel to all the cells of the body
    11·1 answer
  • Who Proposed a theory of gravity?
    10·1 answer
  • We presume that meiosis evolved later than mitosis. What process would not have to evolve in cells undergoing meiosis in order t
    12·1 answer
  • What determines the order in which amino acids are assembled into proteins?
    10·1 answer
  • Write components of xylem and phylem ?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!