1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
babymother [125]
3 years ago
9

The proportions of a population that are at different age levels make up the population’s a. fertility rate. c. age structure. b

. growth rate. d. carrying capacity.
Biology
1 answer:
tester [92]3 years ago
3 0
<span>A: The proportions of a population that are at different age levels make up the population’s age structure. </span>
You might be interested in
Will give brainllest if right
prohojiy [21]

Answer:

Summer

Explanation:

The Northern hemisphere is facing the sun completely, so summer is right.

I hope this right!

6 0
4 years ago
Read 2 more answers
The Krebs cycle forms many products. Which option lists the correct products of the Krebs cycle after 1 molecule of glucose goes
lana66690 [7]

Answer:

Its A

Net 2 NADH, 2 ATP, 4 CO2, 2 FADH2

8 0
3 years ago
5. Which of the following graphs would best represent multiple
Orlov [11]
Bar graph
It’s a bar graph because it’s better for the data to show.
8 0
3 years ago
Read 2 more answers
Small components used to make or repair jewelry are called
monitta

Small components used to make or repair jewelry are called jewelry findings. Jewelry findings are basically components, materials and elements such as clasps, pins, hooks, tabs etc that can be used in making, assembling or repair a piece of jewelry.

3 0
3 years ago
Which of these is correct? A) Oxygen + Sugar → Energy + Carbon dioxide + Water B) Carbon + Sugar → Energy + Carbon dioxide + Wat
AnnZ [28]
The answer of this question is C 
5 0
4 years ago
Other questions:
  • Warm water near the equator rises towards the surface, creating a current. What would you expect to happen to this current if th
    10·2 answers
  • During the process of cell division both plants and animal cells
    15·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Ab blood type is the universal blood recipient because of that type's lack of agglutinogens. ab blood type is the universal bloo
    10·1 answer
  • For centuries, scientists believed that light waves traveled through a substance called "aether." Which of the following facts r
    15·1 answer
  • What is missing from the venn diagram PLEASE HELP!!
    11·1 answer
  • Which of the following is NOT a source of genetic variation in a population ?
    14·2 answers
  • Fatty acids are the building blocks of.
    5·2 answers
  • Choose the correct order of events in the Kreb's cycle:
    12·2 answers
  • Giving brainliest to first correct answer!!!
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!