1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fredd [130]
3 years ago
5

Levene made which contribution to our understanding of DNA structure? a. He determined that the nucleus contains DNA. b. He dete

rmined that DNA contains four nitrogenous bases. c. He determined that DNA consists of nucleotides. d. He determined that the nitrogenous bases of DNA are present in regular ratios.
Biology
1 answer:
Stels [109]3 years ago
8 0

Answer:

The correct answer is  b. He determined that DNA contains four nitrogenous bases.

Explanation:

Levene was an American biochemist who studied the structure of DNA in the early 1900s and in 1920 he found that DNA consists of four nitrogenous bases that are Adenine, Guanine, Thymine, Cytosine.

He also found deoxyribose sugar and phosphate group and said that nucleotide is the basic unit of DNA which contains a ribose sugar with attached nitrogenous base and phosphate group.

He also concludes that an equal amount of adenine, guanine, thymine, and cytosine makes the DNA which is now known as tetranucleotide hypothesis. So the correct answer is b. He determined that DNA contains four nitrogenous bases.  

You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
What is the name of the process where a material that is weak enough to flow will rises when it is hot and sinks when it is cool
aksik [14]

Answer:

Convection process

Explanation:

The process of convection is commonly takes place in the mantle portion of the earth and also at the atmosphere.

This process is usually defined as the process where the materials are heated at a high temperature, thereby making them less denser, and due to their low density they are gradually pushed upward into the upper zones. As the materials rises up, the density gradually increases due to the lowering of the temperature, and then the materials again sinks. This give rise to the formations of a circulating cell, which are commonly known as the convection cells.

7 0
3 years ago
What scientist thought he proved that plants obtain nutrients from water rather than soil
mart [117]
The scientist that thought he had proven that plants obtain their nutrients from water rather than soil is Van Helmont.

7 0
3 years ago
Como se representa la molecula de agua y en cuantas partes
Hitman42 [59]
<span>¡La opinión de un químico sobre el mundo no es tan estrecha como se podría pensar! Sí, empezamos con el átomo, y luego pasamos a las reglas que gobiernan los tipos de unidades estructurales que se pueden hacer con ellos. Se nos enseña tempranamente a predecir las propiedades de la materia en masa de estos arreglos geométricos. Y luego llegamos a H2O, y estamos sorprendidos al descubrir que muchas de estas predicciones están muy lejos, y que el agua (y por implicación, la vida misma) ni siquiera debería existir en nuestro planeta. Pero pronto aprendemos que esta pequeña combinación de tres núcleos y ocho electrones posee propiedades especiales que lo hacen único entre los más de 15 millones de especies químicas que conocemos actualmente. Cuando nos detenemos a reflexionar sobre las consecuencias de esto, la química pasa de ser una ciencia arcana a un viaje de maravilla y placer mientras aprendemos a relacionar el mundo microscópico del átomo con el mundo mayor en el que todos vivimos.</span>
7 0
3 years ago
Read 2 more answers
What structure is missing in a animal cells but present in almost all other all types
Anarel [89]
The cell wall because of the fact it is present in the plant cell and not in the animal cell
4 0
3 years ago
Other questions:
  • If a person has one nonfunctional cone type what would they not be able to identify of an object?
    11·2 answers
  • Which elements are part of an area's topography? Check all that apply.
    10·1 answer
  • A hygrometer is used to measure ____________, and its measurements will differ between climate zones.
    15·1 answer
  • Need help with this ??
    7·2 answers
  • You can locate regions of low wind speed on a weather map by locating: A. regions where isotherms are spaced far apart B. region
    5·1 answer
  • Pls help me answer this question I'm really tired!!
    6·2 answers
  • Rachel Carson was one of the first ecologists to warn against the widespread use
    6·1 answer
  • Will give brainliest answer !
    10·2 answers
  • Which explanation best explains the purpose of DNA replication before the formation of the daughter cell?
    9·1 answer
  • A tropic hormone targets and stimulates an endocrine organ or gland to release another
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!