1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rjkz [21]
3 years ago
5

Show two methods of factoring ax - bx - ay + by

Biology
1 answer:
Allisa [31]3 years ago
8 0
<span>Way #1: ax - bx - ay + by = a(x-y) - b(x-y) = (a-b)(x-y)
</span>Way #2: <span>ax - bx - ay + by = x(a-b) - y(a-b) = (x-y)(a-b)</span>
You might be interested in
How the wildebeest are keystone species and the connection between fires , tree .?
nadezda [96]

Answer:Wildebeest are considered keystone species because their presence has myriad effects on the ecosystem, unlike those of any other species. Wildebeest are the "lawnmowers" of the Serengeti grassland. They keep grass short which in turn reduces the frequency of fires.

7 0
3 years ago
Sulfur dioxide _____.
Lelechka [254]
Sulfur dioxide (also sulphur dioxide) is the chemical compound with the formula SO
2. At standard atmosphere, it is a toxic gas with a pungent, irritating smell. The triple point is 197.69 K and 1.67 kPa. It is released naturally by volcanic activity.

Has an irritating Odor and is colorless
6 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
What process produces identical nuclei with identical amount of chromosomes?
Jobisdone [24]
Mitosis should be the answer. if not that, then cell division. hope this helps :3
4 0
3 years ago
Drag the tiles to the correct boxes to complete the pairs.
kirill [66]

Answer:

Cause: Earth’s magnetosphere traps radioactive  solar wind particles in bands around Earth → Space travel through the Van Allen  belts is dangerous.

Cause: Earth is surrounded by a magnetic field → Effect: Solar wind deflects toward the poles.

Cause: Solar wind particles interact with Earth’s  upper atmosphere → Effect: An aurora is created

Explanation:

I have been able to drag the tiles to the correct boxes to complete the pairs.

When there is a trapping of radioactive solar wind particles in bands by the earth's magnetosphere, it becomes dangerous to travel in space through the Van Allen. Cosmic rays and solar particle add up to the additional hazards that it poses. A Van Allen radiation belt is known to be a zone  where energetic charged particles are found. Most of the energetic charged particles originate from the solar wind.  The solar wind  are captured by and held around a planet by that planet's magnetic field.

When the solar wind interacts with the earth's atmosphere, there is a collision of atoms of oxygen and nitrogen from the earth's atmosphere. The energy that is formed is a colorful glowing halo which is known as an aurora.

3 0
3 years ago
Other questions:
  • What is the maximum number of covalent bonds a carbon Atome conform with other Atoms
    11·1 answer
  • Barbara has curly hair. Her genotype for this trait is CC. What do you infer from this?
    10·1 answer
  • The most common type of muscle contraction encountered with most exercises is ________, meaning the contraction proceeds at a co
    5·2 answers
  • Question from Campbell Biology Chapter 23:
    14·1 answer
  • Can someone please help??
    9·1 answer
  • In which column on the chart below would the information below best fit for a mode of reproduction, CANNOT REPRODUCE WITHOUT A H
    12·1 answer
  • Which type of transport would help the hydrogen ions become more concentrated?
    5·1 answer
  • Which statement best describes how a cell-membrane helps a cell remove waist?
    5·1 answer
  • Plz plz plz help What processes allow continents to change location over time?
    14·2 answers
  • Read about the life cycle of an apple tree, and think about the role apples play in reproduction. Describe how apples help apple
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!