1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ulleksa [173]
2 years ago
8

Which statement describes the role of the organism indicated by the blue arrow in the food web?

Biology
1 answer:
Irina18 [472]2 years ago
4 0
Producers bring energy into the ecosystem by making organic molecules from sunlight or chemical compounds. Producers bring new energy into an ecosystem by breaking down inorganic materials and making new ones.
You might be interested in
What is an insect's antennae most similar too?
Amanda [17]

Insect's antennae is most similar to the <u>nose</u>

They are used for the sense of smell.

6 0
2 years ago
Theodor engelmann broadcast light that had been passed through a prism onto a mat of algae. this exposed different parts of alga
tigry1 [53]
Jimmy hole Tuesday went shopping on Tuesday and it’s pretty cool bcuz that’s where he got his name now go choke on a toenail
5 0
3 years ago
Gabrielle and her friend William had nine identical long, rectangular containers. Gabrielle added water to the containers, filli
olganol [36]

Answer:

1739

Explanation:

4 0
2 years ago
PLSS help
Lina20 [59]

The energy source that is described in the image is light energy from the sun. The correct option is A.

<h3>What is chloroplast?</h3>

Chloroplast is a cell organelle that contains chlorophyll and aids in the process of photosynthesis in the presence of sunlight using carbon dioxide and water.

The missing image of the question is attached as an image.

The energy source that is described in the image is light energy from the sun.

Thus, the correct option is A.

For more details regarding chloroplast, visit:

brainly.com/question/11136550

#SPJ1

6 0
2 years ago
An _________________ is a consumer that eats both plants and animals.
Rudik [331]

Answer: Omnivore

Explanation: A Carnivore eats meat, an Herbivore eats plants, and an Omnivore eats both

5 0
3 years ago
Read 2 more answers
Other questions:
  • What advantage does giving birth in the harshest part of winter give to the grey seal pups?
    6·2 answers
  • Two heterozygous white (brown fur is recessive) rabbits are crossed
    15·1 answer
  • The atmosphere has many functions, such as _____.
    9·2 answers
  • what other substance besides carbon dioxide and water is released in the form of energy during cell respiration during the cell
    12·1 answer
  • Acids have a pH value of
    15·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Cryptographic systems are generically classified by _______.
    11·1 answer
  • Bacteria undergo mitosis and meiosis in order to reproduce and increase genetic recombination.
    13·1 answer
  • The leave of a plant fold inward when it touched as a way to defend themselves from potential harm. What kind of response do the
    10·1 answer
  • Lymphedema is a disorder in which the lymphatic vessels associated with capillary beds are blocked. What will be the long-term e
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!