Use sterile gauze and wipe away from the site of injury
Answer:
True.
Explanation:
Forestry can be defined as the art and science of creating, development, management, conservation and analysis of the living organisms such as plants, trees and woodlands existing in the forest. This is usually done so as to tap into the environmental benefits associated with the forests and to ensure the continuous existence of wildlife, plant growth and development.
Forest Management is a branch of forestry. The field of forest management typically deals with legal, administrative, financial, economical, technical and social aspects of a forest so as to facilitate the smooth running and operation of the forest reserve.
A sustainable forest can be defined as a forest management process which typically involves the plantation of seedlings to replace trees that are being cut down. Thus, sustainable forestry is mainly focused on keeping the natural forest alive.
Generally, certified wood comes from trees grown in sustainable forests i.e responsibly managed forests.
Hence, certified woods are gotten from trees that were harvested in accordance with sustainable forestry.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
I think the answer is D because respiration releases energy.
The concentration of CH3OH in the solution is 2.18M
HOW TO CALCULATE MOLARITY:
- The molarity of a solution can be calculated by dividing the number of moles by its volume as follows:
- Molarity {M} = no. of moles (mol) ÷ volume (L)
- According to this question, 35.0 g of CH3OH (MM = 32.0 g/mol) are dissolved in 500.0 mL of solution. The number of moles of methanol is calculated as follows:
no. of moles = 35g ÷ 32g/mol
no. of moles = 1.09mol
- Molarity = no. of moles ÷ volume
Volume = 500mL = 0.500L
Molarity = 1.09mol ÷ 0.500L
Molarity = 2.18M
Therefore, the concentration of CH3OH in the solution is 2.18M
Learn more at: brainly.com/question/15948514?referrer=searchResults
