1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
4 years ago
14

What is the general term for a disease causing microbe?

Health
1 answer:
Nesterboy [21]4 years ago
6 0
Pathogen would be the term.
You might be interested in
Janelle's doctor warned her that she has extremely high blood pressure, which can lead to a variety of dangerous health problems
frez [133]
<span>To lower her blood pressure, Janelle has to participate in aerobic class. Aerobic exercises help lower the blood pressure and make the heart stronger. Examples of these types of exercise include walking, jogging, jumping, bicycling, skating, rowing, swimming, etc.</span>
7 0
4 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
What has the most calories per serving of all the food items
zaharov [31]
The most would be carbohydrates. they keep you full much longer
7 0
4 years ago
Read 2 more answers
What are at least 2 longer-term consequences of bullying that might affect the kids in these stories?
Liula [17]
Develop depression over time, poor grade and possible drop out of school
4 0
3 years ago
Read 2 more answers
An example of a ball-and-socket joint is the _____.
mestny [16]
The correct answer for the question that is being presented above is this one: "shoulder." An example of a ball-and-socket joint is the shoulder

The correct answer for the question that is being presented above is this one: "scrotum." After sperm are produced, they move into a sperm storage area called scrotum.
3 0
3 years ago
Other questions:
  • People who exaggerate their own importance by talking about themselves, craving attention, and responding negatively to criticis
    5·2 answers
  • Explain the term distress? 
    14·1 answer
  • What's the best way to get rid of a cowlick?
    6·2 answers
  • The stages of grief are not a0 or sequential.
    8·1 answer
  • Space shuttle astronauts each consume an average of 3000 calories per day. one meal normally consists of a main? dish, a vegetab
    15·1 answer
  • When a counselor utilize motivational interviewing, the promotion of self-efficacy?
    13·1 answer
  • What are the three skills and attitudes best promote positive wellness and self esteem
    7·1 answer
  • What are the potential chemical hazards of a sprayed paint mist in a work environment?
    8·2 answers
  • Smoking relieves tension by releasing: options: dopamine. adrenalin. glucose. carbon monoxide.
    9·1 answer
  • 1. Why do you think there is an obesity problem among today's youth?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!