1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kicyunya [14]
3 years ago
8

What do photosynthesis and cellular respiration have in common

Biology
1 answer:
maks197457 [2]3 years ago
7 0
That both include using oxygen and carbon dioxide
You might be interested in
To keep a species from getting genetic diseases and inbreeding over time, new
Elan Coil [88]

Answer:

Genetic drifts and meiosis

Explanation:

4 0
3 years ago
How will a short term environmental change most likely affect organisms within an ecosystem
Sladkaya [172]

Answer:

d. and e. I believe would be the correct answer

4 0
3 years ago
A persons skin and heart cells both have a complete copy of all of the persons chromosomes. Each cell however makes different ty
skad [1K]
Ribosomes.................
6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
In science class,Maria observed that a white colored flower has shades of red when it’s watered with red colored water.she forms
Vikki [24]
Make a chart of the process
7 0
3 years ago
Other questions:
  • Which term is used to describe genes that are located physically close to each other on the same chromosome?
    14·1 answer
  • If you cut a tree trunk into pieces, the resulting pieces and dust add up to the same mass as the original trunk. This is a demo
    9·1 answer
  • In the cell, which organelle has the function of using oxygen in the breakdown of glucose, releasing energy and carbon dioxide?
    7·2 answers
  • What is scientific method?
    9·1 answer
  • Blue poppies native to china were grown at a plant-breeding center in california. the plants with the thickest leaves were most
    5·1 answer
  • What characteristics of living things does a river have?
    6·1 answer
  • Are prokaryotic cells usually longer than eukaryotic cells?
    11·2 answers
  • Which of the following cell structures is responsible for protein synthesis?
    8·2 answers
  • 10. Which respiratory condition below correctly describes what happens during pneumonia? A. The alveoli become damaged and enlar
    9·1 answer
  • What is likely to happen when people have an external locus of control and believe they have a genetic predisposition to cancer?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!