1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solong [7]
3 years ago
8

Science is

Biology
1 answer:
77julia77 [94]3 years ago
4 0
I guess the answer is A,it may help you
You might be interested in
Identify a probable reason that the dark moths survived while the light moths did not.
kirill [66]

Answer:

This question has little context, but I understand what you are trying to say.

The reason why dark moths survived while light moths weren't able to survive is due to the dark moths having conditions that allowed them to camouflage better than the light moths. An environmental condition that would allow this would be the dark moths and the light moths living in the same dark environment.

Explanation:

7 0
3 years ago
Read 2 more answers
What do the following areas of scientific understanding have in common?
lyudmila [28]

Science is a dynamic subject and it changes all the time. In the science field, research is always on going and when new evidence are discovered about a particular topic, the new evidence are usually used to update the scientific information that is already on ground. All the areas of science listed about have enjoyed scientific updates in the recent.

4 0
3 years ago
Why is it argued that speech is only possible in modern homo sapiens and not in homo erectus or homo neanderthalensis? the brain
Oxana [17]

Answer: homo sapiens is the only species with a large enough oral cavity and a low enough larynx to allow for speech production. 

<span>One line of evidence that speech only possible for modern homo sapiens is the anatomy of their throat. Speech depends on certain anatomical arrangements and the Homo sapiens is the only species with a large enough oral cavity and a low enough larynx that would allow speech.</span>

4 0
3 years ago
The organelle responsible for receiving, packaging, and shipping proteins is called the
zmey [24]
It is c your answer for your questions





3 0
3 years ago
Read 2 more answers
The digestive system contains a variety of parts that perform specific functions within the body. The small and large intestines
enyata [817]
Most of the digested food is absorbed in the small intestine-- while the large intestine functions largely to reabsorb water.

Hope this helps!!
3 0
3 years ago
Other questions:
  • What term best describes an organism that can contain up to five levels of organizations
    7·1 answer
  • A forest ecosystem can support a limited number of bears. This is because?
    5·2 answers
  • Explain the role of organic compounds in cellular respiration
    14·1 answer
  • A diploid organism has 90 chromosomes per cell and undergoes mitosis, the resulting organism will have __ chromosomes.
    7·2 answers
  • How can mutation in a gene lead to a new trait in an organism ?
    8·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which organelle contains chemicals that break down substances in the cell?
    12·1 answer
  • How is the immune system related to the skeletal system (bones)?
    6·1 answer
  • The chemical symbols of elements.​
    14·2 answers
  • Antagonistic effects of the sympathetic and parasympathetic divisions of the ANS are ______ effects.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!