1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
2 years ago
14

In addition to natural factors, human activity can also alter ecosystems. Conduct research on a human activity that currently af

fects or can theoretically affect your chosen ecosystem. Use your food web model to explain how this change can affect the competition for food resources.
please help
Biology
1 answer:
Katen [24]2 years ago
6 0

Answer:

<h2><em><u>In addition to natural factors, human activity can also alter ecosystems. Conduct research on a human activity that currently affects or can theoretically affect your chosen ecosystem. Use your food web model to explain how this change can affect the competition for food resources.</u></em></h2>

Explanation:

  • <em><u>ok</u></em>
You might be interested in
If a swimmer cuts his foot on a seashell while wading in the ocean and bleeds into the seawater, his erythrocytes will shrink. W
Tom [10]

Answer:A) The ocean is hypertonic to the erythrocytes.

Explanation:cells shrink when placed in an hypertonic solution.

This shrinkage occurs does to the movement of water out of the cell and through the cell membrane.this phenomenon is called plasmolysis.

The movement of water out of this cell occurs through osmosis.osmosis is the movement of water from a region of high concentration of solute to a region of low concentration of solute, through a semi-permeable membrane.

In this case,sea water has a higher concentration of solute (hypertonic) and the blood cells has a lower concentration(hypotonic) .the cell membrane serves as the semi-permeable membrane and and a result water moves out of the cell

6 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Why do living things need food, water and the ability to get rid of waste?
vaieri [72.5K]
Because water makes everything flow to the digestive track
6 0
2 years ago
Calculate the mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​
aivan3 [116]

weight=mass*gravitational accelaration

we know the weight and the gravitational acceleration

400N=m*10m/s^2

m=400N/10m/2^2

m=40kg

7 0
3 years ago
Read 2 more answers
How do dirty wells and ponds harm us?
shusha [124]
Organic chemicals can enter the grond water and contaminate private wells through waste disposal etc.
3 0
3 years ago
Other questions:
  • How do cells release <br> Energy in the process of cellular respiration
    15·1 answer
  • How was black acacia introduced to California
    9·1 answer
  • How does ATP enable transport to move ions across a cell membrane?
    14·1 answer
  • One way to describe a species is as a population adapted to a certain niche. That population has a small gene pool. If the membe
    11·1 answer
  • Although the outer mitochondrial membrane is permeable to all small molecules, the inner mitochondrial membrane is essentially i
    9·1 answer
  • (( EARTH ScIENCE ))
    11·1 answer
  • What class of rock is basalt?
    11·1 answer
  • How was Cell Theory created?”
    10·1 answer
  • 1. What are viruses made up of?
    13·2 answers
  • I WILL GIVE BRAINLIEST!!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!