1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mrs_skeptik [129]
3 years ago
13

The process of a change in species over long periods of time are called

Biology
1 answer:
dsp733 years ago
7 0

Answer: evolution i think

Explanation:

sorry if its wrong

You might be interested in
Which one of the following molecules can MOST easily pass through the plasma membrane unassisted?
Anton [14]

The molecule that can MOST easily pass through the plasma membrane without assistance is carbon dioxide (CO2). Diffusion is a type of passive transport that occurs when molecules move in favor of a concentration gradient.

During diffusion, molecules move high concentration to a region of low concentration.

Oxygen (O2) and carbon dioxide (CO2) are non-polar gasses that move across cell membranes by a process called simple diffusion.

Simple diffusion is a type of passive transport that does not require energy to move substances across cell membranes.

Learn more in:

brainly.com/question/1619908?referrer=searchResults

4 0
2 years ago
HELP!!! How does the equipment shown in the picture reduce the impact of an oil spill on marine life? A. It absorbs the oil as i
asambeis [7]

Answer:

D

Explanation:

An oil boom helps contain the oil so that it is easier for them to skim it off of the water. They aren't meant to clean up oil, only to contain the oil since it does not sink or mix with water.

5 0
3 years ago
Is half-life is always given in units of time
alexandr1967 [171]
Yes. Half life or better known as Radioactive decay is measured in TIME. Such as seconds, minutes, hours, days, years ect...

:) hope that helps you some, best of luck!
4 0
4 years ago
Blank layers of blank make up the cell membrane
sattari [20]

Answer:

Two layers of Lipids make up the cell membrane

Explanation:

The inner and outer phospholipid layers

3 0
1 year ago
Stress that pushes a mass of rock in two opposite directions is called
lesya [120]
Shearing is a stress that pushes mass in two different directions.
Hope this helped!
3 0
3 years ago
Other questions:
  • Which process produces a greater number of offspring? A) chromosome duplication. B) asexual reproduction. C) gamete formation. D
    12·2 answers
  • What type of transport requires energy to move sodium ions from a low concentration across the intestinal wall into a higher con
    15·2 answers
  • During cell division, centromeres have separated, and chromatids are pulled apart, becoming chromosomes. What happens after the
    5·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Metabolism is _____.
    13·1 answer
  • What conclusion can be drawn from this paragraph? A) time meant nothing to primitive people, B) People today have better memorie
    8·1 answer
  • I'll give you a cookie if answered
    14·2 answers
  • Which era was blue ridge in
    10·1 answer
  • According to the reading, all of the following are true about enzymes except:
    8·1 answer
  • at 21 degrees celcius, a cell with a pressure potential of 3.2 bar is at equilibrium with a 0.420 sucrose solution in an open be
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!