1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miskamm [114]
3 years ago
12

The decision in roe v wade was based upon which rights

Law
1 answer:
klemol [59]3 years ago
7 0

Answer: The Roe V. Wade decision was based upon women’s right to make their own decision when it came to pregnancy. Which can be classified as civil rights or women’s rights.

Explanation:

The decision made in the Roe v. Wade case gave women the right to choose if they wanted an abortion or not.

You might be interested in
On May 15, 2021 a high court in Accra dealt with three different cases: Case 1: Petra construction company Ltd took the ministry
Verdich [7]

Answer:

Case 1 (Fordjour v. Ahmed case on rent) and Case 3 (Giz Construction v. Ministry of Roads on Nonpayment of project ) are civil cases which entail one party by talking the other party to court over money. Ahmed was taken to court by his landlord Fordjour over rent arrears while Minirtsy of Roads was taken to court for non-payment of project by Giz Construction. Case 2 (GRA v. Melcom over Tax payment) is criminal case as it entails Melcom violating laws stipulated by the government.

3 0
2 years ago
What are some possible negative issues with the M'Naghter Rule? Select all that apply.
koban [17]

Answer:

A. Fails to distinguish between violent defendants and one that no longer pose a danger to society.

C. Fails to differentiate between mental illness that are temporary or lifelong conditions.

Explanation:

M'Naghten Rule is an insanity defense used by defendant's attorney to plead defendant not guilty of crime due to mental conditions suffered during the time crime committed.

M'Naghten Rule states that a defendant will be pleaded not guilty only under conditions when it will be proved that the mental condition of defendant was not right at the time when crime was committed and that he/she was not able to discern his/her actions as right or wrong.

The criticism received to the M'Naghten rule is that it fails to distinguish between defendants who pose threat to the society and those who do not pose threat any longer. Another criticism is that it fails to distinguish between mental illness that are temporary or conditions which are lifelong.

Therefore, option A and C are correct.

6 0
2 years ago
7. A lane on a busy street that helps drivers make<br> safer mid-block left turns is called a
klasskru [66]

Answer:

Shared left turn lane

Explanation:

4 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
The fact that the Supreme Court has jurisdiction in a case is no guarantee the justices will hear it.
saul85 [17]
First, the case must be appealled to even make it to the SCOTUS. However, probably the most important condition is that a given case must pose a question about the constitution.
7 0
3 years ago
Other questions:
  • All of the following are considered violent crimes EXCEPT a. murder c. robbery b. rap d. fraud Please select the best answer fro
    6·2 answers
  • For most violations of the law, a police officer can usually exercise a number of options. Five are listed in your textbook, and
    14·1 answer
  • Marijuana is against the law because it is considered?
    5·1 answer
  • In debates leading up to the Three-Fifths Compromise, northern states argued that:  A. slaves should be able to buy their freed
    10·1 answer
  • What is the 2020 standard deduction for a 50-year-old married couple filing jointly, neither of whom is blind?
    7·1 answer
  • To register your vehicle, you'll need _____.
    7·2 answers
  • method of interacting with others respectfully, courteously and with _____________ in the office or workplace.
    14·2 answers
  • In what important way are the supreme court justices different than other government officials?
    5·1 answer
  • The U.S. Constitution establishes that an accused person is presumed to be innocent, until he or she is proven guilty. This part
    14·2 answers
  • The decisions of the federal courts are primarily driven by legal doctrine or individual judges’ political ideology?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!