1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilia_Sergeevich [38]
3 years ago
15

In invertebrates both nitrogenous and digestive wastes are eliminated through the anus because the

Biology
1 answer:
jeyben [28]3 years ago
3 0
<span>In invertebrates both nitrogenous and digestive wastes are eliminated through the anus because the anus is part of the excretory system of the body. It is the opening of the body that is at the opposite end of the mouth after the digestive tract. The anus is found at the end of the alimentary canal where solid waste materials are excreted because they are no longer needed by the body. </span>
You might be interested in
Use the resources provided to either describe in words OR create a model that describes at least 4 reasonable factors that might
Natasha_Volkova [10]

Answer:

Use the resources provided to either describe in words OR create a model that describes at least 4 reasonable factors that might influence the carrying capacity of Nubian ibex in Israel.

Explanation:

Use the resources provided to either describe in words OR create a model that describes at least 4 reasonable factors that might influence the carrying capacity of Nubian ibex in Israel. Use the resources provided to either describe in words OR create a model that describes at least 4 reasonable factors that might influence the carrying capacity of Nubian ibex in Israel. Use the resources provided to either describe in words OR create a model that describes at least 4 reasonable factors that might influence the carrying capacity of Nubian ibex in Israel.

7 0
3 years ago
Hanh set a plant in the middle of his bedroom. The plant began growing toward his bedroom window. What type of response was the
mariarad [96]
The plant is displaying phototropism
5 0
3 years ago
Dipeptide, polipeptide
Liula [17]

Polypeptide:
A chain of amino acids linked together by peptide bonds and having a molecular weight of up to about 10,000.

Dipeptide:

A peptide that yields two amino acids on hydrolysis.

6 0
2 years ago
Biology A Semester Exam
ss7ja [257]

A student's post on photosynthesis can be reliable because he cited multiple high-quality studies from scientific journals.

When we research to show that a hypothesis or idea is true, we need to give it reliable support so that people who read our research trust the conclusions of our research, and it is considered as true knowledge.

To give reliable support to an investigation, it is necessary to resort to feasible arguments or true knowledge developed by researchers and specialists. For this, we must consult sources of reliable information.

Examples of reliable sources of information are:

  • International scientific journals
  • University research
  • Proven scientific evidence
  • Specialized books

According to the above, what the student must do so that his publication is reliable for other students is to cite reliable sources so that the knowledge he is sharing is reliable.

Learn more in: brainly.com/question/10906854

3 0
3 years ago
Viral infection causing blisters on skin of lips, nose, or genitals:(A) Pneumocystis carinii pneumonia (B) Toxoplasmosis (C) Cry
Kitty [74]

Answer:

Letter D, Herpes simplex

Explanation:

Herpes simplex is caused by the herpes virus (HSV). The herpes virus can infect different parts of the body depending on the type of virus.

HSV-1: cusses blisters around the mouth, including eyes in the case of several infections.

HSV-2: responsible for genital infections.  

The signs and symptoms include blistering in the infecting area, itching and flu-like symptoms (fever, headache, etc.)

5 0
3 years ago
Other questions:
  • Suppose a BB female mouse mates with a Bb male mouse. Which of the following represents the probabilities of each genotype occur
    6·1 answer
  • How can you reduce the power consumption in your home
    7·2 answers
  • How does the process of cellular respiration connect autrotrophs<br> to heterotrophs?
    11·1 answer
  • For each of the following statements, indicate
    5·2 answers
  • Females have two of which reproductive structure? A. Uterus B. Vagina C. Urethra D. Ovary
    7·2 answers
  • Determine the type of air mass that typically plays a role in the weather in your area. Describe the
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Digesting food is an example of
    13·2 answers
  • What is the role of the contractile vacuole?
    11·1 answer
  • Think about all the water on Earth’s surface. What causes water droplets to stick together?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!