1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
abruzzese [7]
3 years ago
10

Fat digestion yields fatty acids and glycerol. Protein digestion yields amino acids. Both digestive processes __________.Fat dig

estion yields fatty acids and glycerol. Protein digestion yields amino acids. Both digestive processes __________.require a low pH resulting from HCl productionoccur inside cells in most animalsconsume ATPadd a water molecule to break bonds.
Biology
1 answer:
zepelin [54]3 years ago
6 0

Answer:

add a water molecule to break bonds.

Explanation:

Fat digestion occurs in the small intestine where pH is alkaline. Protein digestion starts in the stomach at acidic pH but is completed in small intestine under the conditions of alkaline pH. Both processes use water molecules to break the covalent bonds of the nutrients. Peptidases present in small intestine add water molecules to the peptide bonds that join two amino acids together. This releases the individual amino acids from peptides. Similarly, the enzyme lipase adds water molecules to break the covalent bonds between fatty acids and glycerol of lipid droplets.

You might be interested in
Name Why do you think some people are against genetic engineering?
n200080 [17]
Genetic engineering need not involve overriding anyone's autonomy
5 0
3 years ago
I need help with all this
andriy [413]

Answer:

good luck

Explanation:

you gonna need it

3 0
3 years ago
A wildlife biologist does a DNA gel to determine how closely related four species of trout are to one another. These are the res
Anarel [89]

Answer:

I'm going to say C. Brown and Rainbow. Please let me know if I am wrong.

Explanation:

Brown and Rainbow have the most lines that are similar compared to the others.

4 0
3 years ago
Read 2 more answers
What is the function of the highlighted muscles
bagirrra123 [75]

<em>Highlighted </em><em>muscles </em><em>are </em><em>the </em><em>muscles </em><em>of </em><em>the </em><em>neck. </em><em>It </em><em>is </em><em>a </em><em>group </em><em>of </em><em>four </em><em>muscles </em><em>which </em><em>helps </em><em>to </em><em>stabilize </em><em>the </em><em>shoulder </em><em>joint. </em>

7 0
3 years ago
The result of the following cross indicates the orange eyes are _____ black eyes. Two aliens of the P generation are crossed. Bo
Dima020 [189]

Answer:

<h2>Recessive to </h2>

Explanation:

1. As given here, both parents are black, and their 247 progeny out of 333 are black, it  clearly indicates that 3/4 progeny is parental phenotype and 1/4 is different type.

2. This clearly show that both parents are heretogyzous, one allele is dominant and one is recessive.

3. Here black is dominant over blue.

4. Dominant allele express them-self in dominant homogyzous as well as heterogyzous condition.

5 0
4 years ago
Other questions:
  • What is the driving force for the movement of materials in the phloem of plants?
    10·1 answer
  • Which of the following is not true concerning the Nereus?
    5·2 answers
  • Which type of mutation always creates a stop codon​
    13·2 answers
  • What was the species concept most used by Linnaeus?
    5·1 answer
  • An example of mitosis at work is a plant root ____.
    11·2 answers
  • How many centimeters can air pressure at sea level push a column of mercury up a tube?
    15·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • PLEASE HELP I'M BEGGING!!!!!!!!!! Uranium-235 is a popular choice of fuel for nuclear reactors. But U-235 doesn't always fission
    7·1 answer
  • What does this pyramid tell us about the population?
    7·2 answers
  • Identify, define and give examples of the three major types of isomers.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!