1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulsSmile [24]
3 years ago
14

Why would a civilization choose to live near a river that regularly floods?

Biology
2 answers:
Virty [35]3 years ago
4 0
I would say it is A. Because it matches and that makes the most sense
Lubov Fominskaja [6]3 years ago
3 0

I think the answer is A. The presence of alluvium in the flood plain

Could you put me as brainliest?

It leaves fertile soil called alluvium along its banks which is good for planting crops

You might be interested in
Renewable resources _____.
hodyreva [135]

can be replenished over months, years, or decades.

7 0
2 years ago
Read 2 more answers
Gerard lives in a tropical region where the average annual temperature is 77°F and the average annual rainfall is more than 100
weqwewe [10]

Answer:

insulated gloves

Explanation:

Answer options:

  • umbrellas
  • insulated gloves
  • raincoats
  • rubber boots

Explanation:

  • The temperature of the region is 77°F which is equal to 25°C.
  • 25°C is not harmful temperature for human skin.
  • The rainfall in the area is enough for the record of data of raincoats, umbrella and rubber boots.
  • So, insulated gloves is the answer.
8 0
3 years ago
After a Chihuahua who has recently given birth presents with muscle tremors and then collapses, the veterinarian diagnoses eclam
Sliva [168]

Answer

D)

Intravenous administration of calcium

3 0
3 years ago
In pea plants, purple flowers (P) are dominant to white flowers (p). What color flowers would the following genotypes produce in
marysya [2.9K]
Need more information
4 0
3 years ago
What is the collection of bones tha run down ur back?
Oduvanchick [21]
Vertebrae/Backbones I think.
5 0
3 years ago
Read 2 more answers
Other questions:
  • One effect of decreasing wolf populations in north america is:
    10·1 answer
  • I'm the entrance to the food tube. I chew the food up well
    5·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Whats the most abundant element in the atmosphere?
    11·1 answer
  • What is occuring when the sound gets louder ? Check all that apply
    10·1 answer
  • In order for an electrical message to be sent from the axon of one neuron to the dendrite of another neuron, it must transverse
    6·1 answer
  • Select each correct answer. More than one answer may be correct.
    12·1 answer
  • Alguien sabe cuál es este animal
    9·1 answer
  • Briefly explain how sexual reproduction generates new allele combinations in offspring.
    11·1 answer
  • Which best describes what happens when an animal does not form a social group?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!