1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nexus9112 [7]
3 years ago
11

What is true for carbohydrates?

Biology
2 answers:
AnnyKZ [126]3 years ago
5 0

Answer:

Carbohydrates span only the interior of a membrane.

Explanation:

Nitella [24]3 years ago
4 0

Answer:

the 3rd one

Explanation:

You might be interested in
It is difficult for blood to clot in wound artery than in wounded vein
Serggg [28]

Explanation:

because the pressure exerted by artery is more than that of vein due to its narrow lumen and thick walls...causing it difficult to clot.

4 0
1 year ago
Select the correct answer.
Aleonysh [2.5K]

Answer:

THE ANSWER IS C

Explanation:

dna replicate during s phase which occurs in interpahse

8 0
3 years ago
What is the purpose of the enclosed seeds in a fruit found on a flowering plant
baherus [9]
The seeds are enclosed because it's the plants way of protecting them.
5 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Why are bacteria used in recombinant DNA technology?
Ainat [17]

Answer:

c. they divide quickly

3 0
3 years ago
Other questions:
  • How are the chromosomes of the offspring related to the chromosomes of the parents?
    15·1 answer
  • Please help LOTS OF POINTS! Question in the pic.
    12·1 answer
  • Presbycusis and tinnitus are examples of difficulties with which of the follows senses
    10·1 answer
  • How many elements have been found to occur in nature? 90 92 96 99
    8·2 answers
  • some microbiologists recommend inoculating a pair of OF basal media (without carbohydrate) along with the carbohydrate media. Wh
    6·2 answers
  • Which of the following is the correct order of steps in the scientific method?
    15·2 answers
  • Answer following questions
    5·1 answer
  • Which of the following two lands features are formed by erosion
    9·1 answer
  • A white colony growing on mannitol salt agar tests negative for coagulase and novobiocin sensitivity. This bacterium is most lik
    10·2 answers
  • Design a conceptual or theoretical to explain how the environment climate change has changed over time and to mitigate these cha
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!