1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLga [1]
3 years ago
10

Which of the following happens when cancer occurs?

Biology
1 answer:
Fittoniya [83]3 years ago
6 0
Normal cells in the body follow an orderly path of growth, division, and death. Programmed cell death is called apoptosis, and when this process breaks down, cancer begins to form.
You might be interested in
An organism that uses light energy to form ATP and can only grow on organic carbon sources is called a
Tanzania [10]
That would be a photoheterotroph
7 0
2 years ago
At what pH values is pepsin likely to be denatured?
san4es73 [151]
Above a pH of 7, pepsin becomes irreversibly denatured. Pepsin was the first enzyme to ever be discovered, and it was discovered by <span>Theodor Schwann.</span>
7 0
3 years ago
Water exists on other planets in the solar system.
ELEN [110]
Liquid.

Earth can sustain life because it contains liquid water.
4 0
3 years ago
Read 2 more answers
A mutation can be passed on to offspring if it occurs in the
aalyn [17]

I believe the correct answer is chromosome.

<h2>Explanation:</h2>

We inherit 23 chromosomes from our mother and another 23 chromosome pairs from our father. You have to inherit a defective chromosome for you to get the mutation. This is what is called germ line mutation usually carried in the sperm or ovum. Of the 23 chromosomes, 22 are autosomal and 1 is chromosomal meaning of the 23 one of them is X and another one is . You get the Y from your father and the X from your mother.

7 0
3 years ago
Julio blows air across his hot bowl of soup. The tiny ripples he creates are similar to
Bad White [126]
The answer would be Cyclones
8 0
3 years ago
Read 2 more answers
Other questions:
  • What would happen to a plant cell during a period of severe drought?
    7·2 answers
  • The nurse is assessing a client who has syndrome of inappropriate antidiuretic hormone (siadh). which finding in the client is c
    5·2 answers
  • Name and describe the purpose of two major missions in space exploration. need asap will mark brainliest
    11·1 answer
  • In addition to their circular chromosome bacteria also have smaller rings of DNA called
    13·1 answer
  • Are food webs different to food chains? Explain why food webs are more<br> useful.
    8·1 answer
  • What type of conditions can lead to the development of karst topography?
    6·1 answer
  • Why can’t the evolutionary relationships between certain species be explained thoroughly?
    5·1 answer
  • Which of the following is composed of more than two hundred billion stars, including the sun? (1 point)
    8·1 answer
  • 2. Which of these is a behavioral adaptation?
    14·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!