1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lesya692 [45]
3 years ago
13

Assume that the number of different types of bases in RNA is four. What would be the minimum codon size (number of nucleotides)

required to specify all amino acids if the number of different types of amino acids in proteins were:
Biology
1 answer:
Fofino [41]3 years ago
5 0

The complete question is:

What would be the minimum codon size (number of nucleotides) required to specify all amino acids if the number of different types of amino acids in proteins were: (1) 2, (2) 8, (3) 17, (4) 45, (5) 75?

Answers:

1) 1

2) 2

3) 3

4) 3

5) 4

These calculation take into account:  

Available bases^ codon size

(* nucleotides)=* possible codons

You might be interested in
Many Caribbean reefs face multiple environmental and biological threats. You can use the Coral Reefs Gizmo to design your own ex
sukhopar [10]

Answer:

We need two types of environment for this experiment.

Explanation:

We need two types of environment to see the environmental effects on Caribbean reefs. In one environment we have to provide control and optimum environmental as well as biological conditions such as pH and no pollutants etc while on the other hand, we placed the Caribbean reefs in the open environment where environmental conditions are not suitable such as low pH, pollutants, algal blooms etc occurs. So we can see that the first environment have high growth rate of Caribbean reefs whereas the second environment has lower growth of Caribbean reefs due to low pH of the ocean water which prevent the growth of reef's skeleton so the conclusion of this discussion is that Caribbean reefs is negatively affected by environmental conditions.

5 0
3 years ago
Which part of an amino acid is always acidic?
STALIN [3.7K]
Amino acids contain a acidic carboxylic acid group connected to their alpha carbon.<span> The alpha carbon is also connected to an amine group and an R group that is distinct to each amino acid.</span>
6 0
3 years ago
Read 2 more answers
Decomposition is an important part of which nutrient cycle(s)?
Juliette [100K]
D. Carbon nitrogen and phosphorus
6 0
4 years ago
PLEASE HELP ME!!!
STatiana [176]
I think it’s A answer
5 0
3 years ago
Read 2 more answers
What kind of virus infects bacteria
Marina CMI [18]
The answer is.... (DRUMROLL).... <span>Bacteriophages</span>
4 0
3 years ago
Other questions:
  • ASAP
    14·1 answer
  • Which statements about this diagram are true? Check all that apply. Layers 5 and 7 are the same age. Faulting created the differ
    6·2 answers
  • List the following biomes in order from lowest average temperature to highest average temperature. Tundra, desert, taiga, temper
    14·2 answers
  • The observable, measurable outward characteristics of an organism are called the
    5·1 answer
  • How does cell growth affect the ability of a cell to exchange materials with its environment?
    14·1 answer
  • In a study of proteins mediating cell membrane transport, microbiologists measure current versus time through the cell membranes
    15·2 answers
  • One difference between prokaryotic cells and eukaryotic cells is that
    15·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • What two element where found in the sun
    11·2 answers
  • PLEASE HELP MEEEEEEEE ILL MARK YOU AS BRAINISET
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!